EMAIL THIS PAGE TO A FRIEND

FMNL2

formin-like 2

128 Gene Product Result for
Synonyms: FHOD2
UniProtKB ID: Q96PY5, B2RZH5, Q14CC9, Q4ZG52, Q8N3E0
Gene ID:
Human(114793) Summary: This gene encodes a formin-related protein. Formin-related proteins have been implicated in morphogenesis, cytokinesis, and cell polarity. Alternatively spliced transcript variants encoding different isoforms have been described but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(71409) formin-like 2
Rat(311033) formin-like 2
sheep(101116803) formin-like 2
chicken(771739) formin-like 2
cow(789338) formin-like 2
cow(788312) formin-like 2
domestic cat(101081067) formin-like 2
dog(476151) formin-like 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052905 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052905 Rosetta Predictions human pricing
XM_229959 Rosetta Predictions rat pricing
NM_172409 Rosetta Predictions mouse pricing
XM_901882 Rosetta Predictions mouse pricing
XM_901887 Rosetta Predictions mouse pricing
XM_901889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144237 predicted 2897
2 SASI_Hs02_00361655 predicted 755
3 SASI_Hs01_00144239 predicted 674
4 SASI_Hs01_00144240 predicted 3101
5 SASI_Hs01_00144241 predicted 1392
6 SASI_Hs02_00361656 predicted 1321
7 SASI_Hs01_00144242 predicted 3478
8 SASI_Hs01_00144245 predicted 2942
9 SASI_Hs01_00144246 predicted 2555
10 SASI_Hs02_00361657 predicted 2668
11 SASI_Hs01_00144238 predicted 3701
12 SASI_Hs01_00144243 predicted 3349
13 SASI_Hs01_00144244 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141486 predicted 1288
2 SASI_Rn01_00141487 predicted 382
3 SASI_Rn01_00141488 predicted 917
4 SASI_Rn01_00141489 predicted 225
5 SASI_Rn01_00141490 predicted 923
6 SASI_Rn01_00141491 predicted 439
7 SASI_Rn01_00141492 predicted 374
8 SASI_Rn01_00141493 predicted 530
9 SASI_Rn01_00141494 predicted 831
10 SASI_Rn01_00141495 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343871 predicted 2225
2 SASI_Mm02_00343872 predicted 3308
3 SASI_Mm02_00343873 predicted 2243
4 SASI_Mm02_00343874 predicted 3570
5 SASI_Mm02_00343875 predicted 2775
6 SASI_Mm02_00343876 predicted 1583
7 SASI_Mm02_00343877 predicted 2787
8 SASI_Mm02_00343878 predicted 916
9 SASI_Mm02_00343879 predicted 2499
10 SASI_Mm02_00343880 predicted 2219
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219548 predicted 2647
2 SASI_Mm01_00219549 predicted 2659
3 SASI_Mm01_00219550 predicted 2520
4 SASI_Mm01_00219551 predicted 2561
5 SASI_Mm01_00219552 predicted 2677
6 SASI_Mm01_00219553 predicted 2501
7 SASI_Mm01_00219554 predicted 2420
8 SASI_Mm01_00219555 predicted 2414
9 SASI_Mm01_00219556 predicted 2436
10 SASI_Mm01_00219557 predicted 2551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234609 predicted 2655
2 SASI_Mm01_00234610 predicted 2663
3 SASI_Mm01_00234611 predicted 1708
4 SASI_Mm01_00234612 predicted 2573
5 SASI_Mm01_00234613 predicted 1706
6 SASI_Mm01_00234614 predicted 2689
7 SASI_Mm01_00234615 predicted 2507
8 SASI_Mm01_00234616 predicted 2432
9 SASI_Mm01_00234617 predicted 2422
10 SASI_Mm01_00234618 predicted 2452
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209095 predicted 2659
2 SASI_Mm01_00209096 predicted 2666
3 SASI_Mm01_00209097 predicted 1707
4 SASI_Mm01_00209098 predicted 2569
5 SASI_Mm01_00209099 predicted 1696
6 SASI_Mm01_00209100 predicted 2693
7 SASI_Mm01_00209101 predicted 2504
8 SASI_Mm01_00209102 predicted 2429
9 SASI_Mm01_00209103 predicted 2424
10 SASI_Mm01_00209104 predicted 2453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052905
VALIDATED
FMNL2 MISSION shRNA Bacterial Glycerol Stock
formin-like 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052905.3-3292s21c1
Sequence:CCGGCCGGTTTGTGAAAGCATATAACTCGAGTTATATGCTTTCACAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-3703s21c1
Sequence:CCGGACTTTATGTGCTACGATTTAACTCGAGTTAAATCGTAGCACATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-950s21c1
Sequence:CCGGCATTCTGCACTGCGATATAATCTCGAGATTATATCGCAGTGCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-1049s21c1
Sequence:CCGGTTACGTGCCATCATGAATTATCTCGAGATAATTCATGATGGCACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-3618s21c1
Sequence:CCGGCTGTTAATGGTGCCGAAATAACTCGAGTTATTTCGGCACCATTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-2948s21c1
Sequence:CCGGCAAACACTGTTGCACTATATACTCGAGTATATAGTGCAACAGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052905.1-2536s1c1
Sequence:CCGGCCTCAACTACATGCGATTATACTCGAGTATAATCGCATGTAGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052905.1-2618s1c1
Sequence:CCGGCCCTTGGAAACTACATGAATACTCGAGTATTCATGTAGTTTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052905.1-280s1c1
Sequence:CCGGGCCAGGTTACTGCGGCAGTATCTCGAGATACTGCCGCAGTAACCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052905.1-744s1c1
Sequence:CCGGGCCAAGCAGAAGAACTCTGAACTCGAGTTCAGAGTTCTTCTGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052905.1-1179s1c1
Sequence:CCGGCCTGGACGAATACTTGGACAACTCGAGTTGTCCAAGTATTCGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052905
VALIDATED
FMNL2 MISSION shRNA shRNA Plasmid DNA
formin-like 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052905.3-3292s21c1
Sequence:CCGGCCGGTTTGTGAAAGCATATAACTCGAGTTATATGCTTTCACAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-3703s21c1
Sequence:CCGGACTTTATGTGCTACGATTTAACTCGAGTTAAATCGTAGCACATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-950s21c1
Sequence:CCGGCATTCTGCACTGCGATATAATCTCGAGATTATATCGCAGTGCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-1049s21c1
Sequence:CCGGTTACGTGCCATCATGAATTATCTCGAGATAATTCATGATGGCACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-3618s21c1
Sequence:CCGGCTGTTAATGGTGCCGAAATAACTCGAGTTATTTCGGCACCATTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-2948s21c1
Sequence:CCGGCAAACACTGTTGCACTATATACTCGAGTATATAGTGCAACAGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052905.1-2536s1c1
Sequence:CCGGCCTCAACTACATGCGATTATACTCGAGTATAATCGCATGTAGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052905.1-2618s1c1
Sequence:CCGGCCCTTGGAAACTACATGAATACTCGAGTATTCATGTAGTTTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052905.1-280s1c1
Sequence:CCGGGCCAGGTTACTGCGGCAGTATCTCGAGATACTGCCGCAGTAACCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052905.1-744s1c1
Sequence:CCGGGCCAAGCAGAAGAACTCTGAACTCGAGTTCAGAGTTCTTCTGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052905.1-1179s1c1
Sequence:CCGGCCTGGACGAATACTTGGACAACTCGAGTTGTCCAAGTATTCGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052905
VALIDATED
FMNL2 MISSION shRNA Lentiviral Transduction Particles
formin-like 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052905.3-3292s21c1
Sequence:CCGGCCGGTTTGTGAAAGCATATAACTCGAGTTATATGCTTTCACAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-3703s21c1
Sequence:CCGGACTTTATGTGCTACGATTTAACTCGAGTTAAATCGTAGCACATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-950s21c1
Sequence:CCGGCATTCTGCACTGCGATATAATCTCGAGATTATATCGCAGTGCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-1049s21c1
Sequence:CCGGTTACGTGCCATCATGAATTATCTCGAGATAATTCATGATGGCACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-3618s21c1
Sequence:CCGGCTGTTAATGGTGCCGAAATAACTCGAGTTATTTCGGCACCATTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052905.3-2948s21c1
Sequence:CCGGCAAACACTGTTGCACTATATACTCGAGTATATAGTGCAACAGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052905.1-2536s1c1
Sequence:CCGGCCTCAACTACATGCGATTATACTCGAGTATAATCGCATGTAGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052905.1-2618s1c1
Sequence:CCGGCCCTTGGAAACTACATGAATACTCGAGTATTCATGTAGTTTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052905.1-280s1c1
Sequence:CCGGGCCAGGTTACTGCGGCAGTATCTCGAGATACTGCCGCAGTAACCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052905.1-744s1c1
Sequence:CCGGGCCAAGCAGAAGAACTCTGAACTCGAGTTCAGAGTTCTTCTGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052905.1-1179s1c1
Sequence:CCGGCCTGGACGAATACTTGGACAACTCGAGTTGTCCAAGTATTCGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172409
VALIDATED
FMNL2 MISSION shRNA Bacterial Glycerol Stock
formin-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-4582s21c1
Sequence:CCGGTTATCCGCGATAGGGTTAAATCTCGAGATTTAACCCTATCGCGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-2670s21c1
Sequence:CCGGCCTCAACTTCACGCAATTATACTCGAGTATAATTGCGTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-675s21c1
Sequence:CCGGGATGTTCTTGTGGAGTATTTGCTCGAGCAAATACTCCACAAGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-2853s21c1
Sequence:CCGGCAAACACTGTTGCACTATATACTCGAGTATATAGTGCAACAGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-858s21c1
Sequence:CCGGCATTCTGCACTTCGATATAATCTCGAGATTATATCGAAGTGCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172409
VALIDATED
FMNL2 MISSION shRNA shRNA Plasmid DNA
formin-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-4582s21c1
Sequence:CCGGTTATCCGCGATAGGGTTAAATCTCGAGATTTAACCCTATCGCGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-2670s21c1
Sequence:CCGGCCTCAACTTCACGCAATTATACTCGAGTATAATTGCGTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-675s21c1
Sequence:CCGGGATGTTCTTGTGGAGTATTTGCTCGAGCAAATACTCCACAAGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-2853s21c1
Sequence:CCGGCAAACACTGTTGCACTATATACTCGAGTATATAGTGCAACAGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-858s21c1
Sequence:CCGGCATTCTGCACTTCGATATAATCTCGAGATTATATCGAAGTGCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172409
VALIDATED
FMNL2 MISSION shRNA Lentiviral Transduction Particles
formin-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-4582s21c1
Sequence:CCGGTTATCCGCGATAGGGTTAAATCTCGAGATTTAACCCTATCGCGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-2670s21c1
Sequence:CCGGCCTCAACTTCACGCAATTATACTCGAGTATAATTGCGTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-675s21c1
Sequence:CCGGGATGTTCTTGTGGAGTATTTGCTCGAGCAAATACTCCACAAGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-2853s21c1
Sequence:CCGGCAAACACTGTTGCACTATATACTCGAGTATATAGTGCAACAGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172409.2-858s21c1
Sequence:CCGGCATTCTGCACTTCGATATAATCTCGAGATTATATCGAAGTGCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks