EMAIL THIS PAGE TO A FRIEND

FMNL3

formin-like 3

173 Gene Product Result for
Synonyms: FHOD3 WBP-3 WBP3
UniProtKB ID: Q8IVF7, B0JZA7, Q6ZRJ1
Gene ID:
Human(91010) Summary: The protein encoded by this gene contains a formin homology 2 domain and has high sequence identity to the mouse Wbp3 protein. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(22379) formin-like 3
Rat(300225) formin-like 3
Zebrafish(407694) formin-like 3
cow(540105) formin-like 3
Horse(100059687) formin-like 3
domestic cat(101083946) formin-like 3
dog(486555) formin-like 3
sheep(101122937) formin-like 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175736 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175736 Rosetta Predictions human pricing
NM_198900 Rosetta Predictions human pricing
XM_001063650 Rosetta Predictions rat pricing
XR_005956 Rosetta Predictions rat pricing
NM_011711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048540 predicted 2226
2 SASI_Hs01_00048541 predicted 2050
3 SASI_Hs02_00369080 predicted 363
4 SASI_Hs01_00048542 predicted 2971
5 SASI_Hs01_00048543 predicted 1617
6 SASI_Hs01_00048544 predicted 2859
7 SASI_Hs01_00048545 predicted 1350
8 SASI_Hs01_00048546 predicted 1483
9 SASI_Hs01_00048547 predicted 2844
10 SASI_Hs01_00048548 predicted 406
11 SASI_Hs01_00048549 predicted 2386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073271 predicted 2073
2 SASI_Hs01_00073272 predicted 1897
3 SASI_Hs02_00372398 predicted 363
4 SASI_Hs01_00073273 predicted 2818
5 SASI_Hs01_00073274 predicted 1468
6 SASI_Hs01_00073275 predicted 2700
7 SASI_Hs01_00073276 predicted 1190
8 SASI_Hs01_00073277 predicted 1329
9 SASI_Hs01_00073278 predicted 2692
10 SASI_Hs01_00073279 predicted 408
11 SASI_Hs01_00073280 predicted 2235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307908 predicted 521
2 SASI_Rn02_00307909 predicted 359
3 SASI_Rn02_00307910 predicted 1986
4 SASI_Rn02_00307911 predicted 1267
5 SASI_Rn02_00307912 predicted 1487
6 SASI_Rn02_00307913 predicted 2177
7 SASI_Rn02_00307914 predicted 2390
8 SASI_Rn02_00307915 predicted 2245
9 SASI_Rn02_00307916 predicted 3246
10 SASI_Rn02_00307917 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00410647 predicted 487
2 SASI_Rn02_00410648 predicted 323
3 SASI_Rn01_00144917 predicted 1241
4 SASI_Rn01_00144918 predicted 1461
5 SASI_Rn01_00144920 predicted 2345
6 SASI_Rn01_00144921 predicted 2211
7 SASI_Rn02_00410649 predicted 2414
8 SASI_Rn02_00410650 predicted 1205
9 SASI_Rn02_00410651 predicted 903
10 SASI_Rn02_00410652 predicted 1468
11 SASI_Rn01_00144919 predicted 1361
12 SASI_Rn01_00144922 predicted 2543
13 SASI_Rn01_00144923 predicted 1621
14 SASI_Rn01_00144924 predicted 2194
15 SASI_Rn01_00144925 predicted 1304
16 SASI_Rn01_00144926 predicted 1505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044120 predicted 1903
2 SASI_Mm01_00044121 predicted 1254
3 SASI_Mm01_00044122 predicted 477
4 SASI_Mm01_00044123 predicted 1060
5 SASI_Mm01_00044124 predicted 1976
6 SASI_Mm02_00321279 predicted 917
7 SASI_Mm01_00044125 predicted 2784
8 SASI_Mm01_00044126 predicted 855
9 SASI_Mm01_00044127 predicted 2614
10 SASI_Mm01_00044128 predicted 2229
11 SASI_Mm01_00044119 predicted 511
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011711
VALIDATED
FMNL3 MISSION shRNA Bacterial Glycerol Stock
formin-like 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011711.1-3543s1c1
Sequence:CCGGCCCAAGTCTTCAACTTCATTTCTCGAGAAATGAAGTTGAAGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011711.1-1026s1c1
Sequence:CCGGGCTGCCTTTGACAATTTCAAACTCGAGTTTGAAATTGTCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011711.1-578s1c1
Sequence:CCGGGCTGGTGGATTACCTGTCATTCTCGAGAATGACAGGTAATCCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011711.1-2967s1c1
Sequence:CCGGCGCAAGAAACAAGAGGAGGTACTCGAGTACCTCCTCTTGTTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011711.1-3543s21c1
Sequence:CCGGCCCAAGTCTTCAACTTCATTTCTCGAGAAATGAAGTTGAAGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011711.1-1520s21c1
Sequence:CCGGTACTCTTCGGAGGCTCATTAACTCGAGTTAATGAGCCTCCGAAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011711.1-578s21c1
Sequence:CCGGGCTGGTGGATTACCTGTCATTCTCGAGAATGACAGGTAATCCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011711.1-1026s21c1
Sequence:CCGGGCTGCCTTTGACAATTTCAAACTCGAGTTTGAAATTGTCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011711
VALIDATED
FMNL3 MISSION shRNA shRNA Plasmid DNA
formin-like 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011711.1-3543s1c1
Sequence:CCGGCCCAAGTCTTCAACTTCATTTCTCGAGAAATGAAGTTGAAGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011711.1-1026s1c1
Sequence:CCGGGCTGCCTTTGACAATTTCAAACTCGAGTTTGAAATTGTCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011711.1-578s1c1
Sequence:CCGGGCTGGTGGATTACCTGTCATTCTCGAGAATGACAGGTAATCCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011711.1-2967s1c1
Sequence:CCGGCGCAAGAAACAAGAGGAGGTACTCGAGTACCTCCTCTTGTTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011711.1-3543s21c1
Sequence:CCGGCCCAAGTCTTCAACTTCATTTCTCGAGAAATGAAGTTGAAGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011711.1-1520s21c1
Sequence:CCGGTACTCTTCGGAGGCTCATTAACTCGAGTTAATGAGCCTCCGAAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011711.1-578s21c1
Sequence:CCGGGCTGGTGGATTACCTGTCATTCTCGAGAATGACAGGTAATCCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011711.1-1026s21c1
Sequence:CCGGGCTGCCTTTGACAATTTCAAACTCGAGTTTGAAATTGTCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011711
VALIDATED
FMNL3 MISSION shRNA Lentiviral Transduction Particles
formin-like 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011711.1-3543s1c1
Sequence:CCGGCCCAAGTCTTCAACTTCATTTCTCGAGAAATGAAGTTGAAGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011711.1-1026s1c1
Sequence:CCGGGCTGCCTTTGACAATTTCAAACTCGAGTTTGAAATTGTCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011711.1-578s1c1
Sequence:CCGGGCTGGTGGATTACCTGTCATTCTCGAGAATGACAGGTAATCCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011711.1-2967s1c1
Sequence:CCGGCGCAAGAAACAAGAGGAGGTACTCGAGTACCTCCTCTTGTTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011711.1-3543s21c1
Sequence:CCGGCCCAAGTCTTCAACTTCATTTCTCGAGAAATGAAGTTGAAGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011711.1-1520s21c1
Sequence:CCGGTACTCTTCGGAGGCTCATTAACTCGAGTTAATGAGCCTCCGAAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011711.1-578s21c1
Sequence:CCGGGCTGGTGGATTACCTGTCATTCTCGAGAATGACAGGTAATCCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011711.1-1026s21c1
Sequence:CCGGGCTGCCTTTGACAATTTCAAACTCGAGTTTGAAATTGTCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175736
FMNL3 MISSION shRNA Bacterial Glycerol Stock
formin-like 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175736.3-1344s1c1
Sequence:CCGGGAGAGCATCAAGGAGACATATCTCGAGATATGTCTCCTTGATGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175736.3-737s1c1
Sequence:CCGGGAACTATCAGTACGGATTCAACTCGAGTTGAATCCGTACTGATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175736.4-2305s21c1
Sequence:CCGGGTAAAGCTGCTGCGGCAATATCTCGAGATATTGCCGCAGCAGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175736.4-1899s21c1
Sequence:CCGGCCTGTCAGCCATTCGAATTAACTCGAGTTAATTCGAATGGCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175736.4-7590s21c1
Sequence:CCGGCCTACCCTTTGGGTCTATTTACTCGAGTAAATAGACCCAAAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175736.4-1352s21c1
Sequence:CCGGCATATCTGGACAACGTGTTTGCTCGAGCAAACACGTTGTCCAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175736.4-2989s21c1
Sequence:CCGGGTCCGATTCATTCGTTCTTACCTCGAGGTAAGAACGAATGAATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175736
FMNL3 MISSION shRNA shRNA Plasmid DNA
formin-like 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175736.3-1344s1c1
Sequence:CCGGGAGAGCATCAAGGAGACATATCTCGAGATATGTCTCCTTGATGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175736.3-737s1c1
Sequence:CCGGGAACTATCAGTACGGATTCAACTCGAGTTGAATCCGTACTGATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175736.4-2305s21c1
Sequence:CCGGGTAAAGCTGCTGCGGCAATATCTCGAGATATTGCCGCAGCAGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175736.4-1899s21c1
Sequence:CCGGCCTGTCAGCCATTCGAATTAACTCGAGTTAATTCGAATGGCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175736.4-7590s21c1
Sequence:CCGGCCTACCCTTTGGGTCTATTTACTCGAGTAAATAGACCCAAAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175736.4-1352s21c1
Sequence:CCGGCATATCTGGACAACGTGTTTGCTCGAGCAAACACGTTGTCCAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175736.4-2989s21c1
Sequence:CCGGGTCCGATTCATTCGTTCTTACCTCGAGGTAAGAACGAATGAATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175736
FMNL3 MISSION shRNA Lentiviral Transduction Particles
formin-like 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175736.3-1344s1c1
Sequence:CCGGGAGAGCATCAAGGAGACATATCTCGAGATATGTCTCCTTGATGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175736.3-737s1c1
Sequence:CCGGGAACTATCAGTACGGATTCAACTCGAGTTGAATCCGTACTGATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175736.4-2305s21c1
Sequence:CCGGGTAAAGCTGCTGCGGCAATATCTCGAGATATTGCCGCAGCAGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175736.4-1899s21c1
Sequence:CCGGCCTGTCAGCCATTCGAATTAACTCGAGTTAATTCGAATGGCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175736.4-7590s21c1
Sequence:CCGGCCTACCCTTTGGGTCTATTTACTCGAGTAAATAGACCCAAAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175736.4-1352s21c1
Sequence:CCGGCATATCTGGACAACGTGTTTGCTCGAGCAAACACGTTGTCCAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175736.4-2989s21c1
Sequence:CCGGGTCCGATTCATTCGTTCTTACCTCGAGGTAAGAACGAATGAATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks