EMAIL THIS PAGE TO A FRIEND

FMO1

flavin containing monooxygenase 1

60 Gene Product Result for
UniProtKB ID: Q01740, A8K248, Q5QPT2, Q9UJC2
Gene ID:
Human(2326) Summary: Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jul 2008]
Mouse(14261) flavin containing monooxygenase 1
Rat(25256) flavin containing monooxygenase 1
Thale Cress(838508) flavin-dependent monooxygenase 1
cow(508781) flavin containing monooxygenase 1
dog(403604) flavin containing monooxygenase 1
domestic cat(101087122) flavin containing monooxygenase 1
naked mole-rat(101709396) flavin containing monooxygenase 1
domestic guinea pig(100723945) flavin containing monooxygenase 1
sheep(101105089) flavin containing monooxygenase 1
Domestic Rabbit(100009120) flavin containing monooxygenase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002021 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059621 MISSION® esiRNA esiRNA human FMO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002021 Rosetta Predictions human pricing
NM_012792 Rosetta Predictions rat pricing
NM_010231 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094139 predicted 1058
2 SASI_Hs02_00333037 predicted 212
3 SASI_Hs01_00094140 predicted 581
4 SASI_Hs01_00094142 predicted 1196
5 SASI_Hs01_00094144 predicted 410
6 SASI_Hs01_00094145 predicted 1459
7 SASI_Hs01_00094146 predicted 1590
8 SASI_Hs01_00094147 predicted 1698
9 SASI_Hs01_00094148 predicted 595
10 SASI_Hs02_00333038 predicted 373
11 SASI_Hs01_00094141 predicted 937
12 SASI_Hs01_00094143 predicted 1738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012792 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098383 predicted 1000
2 SASI_Rn01_00098384 predicted 822
3 SASI_Rn01_00098385 predicted 1698
4 SASI_Rn01_00098386 predicted 200
5 SASI_Rn01_00098387 predicted 274
6 SASI_Rn01_00098389 predicted 1215
7 SASI_Rn01_00098390 predicted 1664
8 SASI_Rn01_00098391 predicted 1053
9 SASI_Rn01_00098392 predicted 1144
10 SASI_Rn02_00260216 predicted 1672
11 SASI_Rn01_00098388 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130721 predicted 1220
2 SASI_Mm01_00130722 predicted 570
3 SASI_Mm01_00130723 predicted 635
4 SASI_Mm01_00130724 predicted 1268
5 SASI_Mm01_00130725 predicted 436
6 SASI_Mm01_00130726 predicted 1114
7 SASI_Mm01_00130728 predicted 1055
8 SASI_Mm02_00318089 predicted 1517
9 SASI_Mm01_00130729 predicted 1947
10 SASI_Mm01_00130730 predicted 1963
11 SASI_Mm01_00130727 predicted 610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002021
FMO1 MISSION shRNA Bacterial Glycerol Stock
flavin containing monooxygenase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002021.1-1186s21c1
Sequence:CCGGAGCCAACCCTGGCCATTATTGCTCGAGCAATAATGGCCAGGGTTGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002021.1-1766s21c1
Sequence:CCGGATATTGCCTTCACAGTTATAACTCGAGTTATAACTGTGAAGGCAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002021.1-606s21c1
Sequence:CCGGTACTTTCATAGCCGGCAATATCTCGAGATATTGCCGGCTATGAAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-1059s1c1
Sequence:CCGGCCTATTGACATCATTGTCTTTCTCGAGAAAGACAATGATGTCAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-894s1c1
Sequence:CCGGCATGCAAATTACGGCTTAATACTCGAGTATTAAGCCGTAATTTGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-216s1c1
Sequence:CCGGCTGTGGAGATTCACCGAACATCTCGAGATGTTCGGTGAATCTCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-320s1c1
Sequence:CCGGCCCAGAAGATTATCCAAACTACTCGAGTAGTTTGGATAATCTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-1269s1c1
Sequence:CCGGCGAGTCCTGAAAGGTGTAAATCTCGAGATTTACACCTTTCAGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002021
FMO1 MISSION shRNA shRNA Plasmid DNA
flavin containing monooxygenase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002021.1-1186s21c1
Sequence:CCGGAGCCAACCCTGGCCATTATTGCTCGAGCAATAATGGCCAGGGTTGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002021.1-1766s21c1
Sequence:CCGGATATTGCCTTCACAGTTATAACTCGAGTTATAACTGTGAAGGCAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002021.1-606s21c1
Sequence:CCGGTACTTTCATAGCCGGCAATATCTCGAGATATTGCCGGCTATGAAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-1059s1c1
Sequence:CCGGCCTATTGACATCATTGTCTTTCTCGAGAAAGACAATGATGTCAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-894s1c1
Sequence:CCGGCATGCAAATTACGGCTTAATACTCGAGTATTAAGCCGTAATTTGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-216s1c1
Sequence:CCGGCTGTGGAGATTCACCGAACATCTCGAGATGTTCGGTGAATCTCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-320s1c1
Sequence:CCGGCCCAGAAGATTATCCAAACTACTCGAGTAGTTTGGATAATCTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-1269s1c1
Sequence:CCGGCGAGTCCTGAAAGGTGTAAATCTCGAGATTTACACCTTTCAGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002021
FMO1 MISSION shRNA Lentiviral Transduction Particles
flavin containing monooxygenase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002021.1-1186s21c1
Sequence:CCGGAGCCAACCCTGGCCATTATTGCTCGAGCAATAATGGCCAGGGTTGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002021.1-1766s21c1
Sequence:CCGGATATTGCCTTCACAGTTATAACTCGAGTTATAACTGTGAAGGCAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002021.1-606s21c1
Sequence:CCGGTACTTTCATAGCCGGCAATATCTCGAGATATTGCCGGCTATGAAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-1059s1c1
Sequence:CCGGCCTATTGACATCATTGTCTTTCTCGAGAAAGACAATGATGTCAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-894s1c1
Sequence:CCGGCATGCAAATTACGGCTTAATACTCGAGTATTAAGCCGTAATTTGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-216s1c1
Sequence:CCGGCTGTGGAGATTCACCGAACATCTCGAGATGTTCGGTGAATCTCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-320s1c1
Sequence:CCGGCCCAGAAGATTATCCAAACTACTCGAGTAGTTTGGATAATCTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002021.1-1269s1c1
Sequence:CCGGCGAGTCCTGAAAGGTGTAAATCTCGAGATTTACACCTTTCAGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010231
FMO1 MISSION shRNA Bacterial Glycerol Stock
flavin containing monooxygenase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010231.2-2178s1c1
Sequence:CCGGCCAGAGAATACTCTGAGCATTCTCGAGAATGCTCAGAGTATTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010231.2-1277s1c1
Sequence:CCGGCCCATTGACATCATCGTCTTTCTCGAGAAAGACGATGATGTCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010231.2-1327s1c1
Sequence:CCGGCCTCGATGAATCCGTAGTGAACTCGAGTTCACTACGGATTCATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010231.2-539s1c1
Sequence:CCGGCCAGAAGACTATCCAAACTTTCTCGAGAAAGTTTGGATAGTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010231.2-1328s1c1
Sequence:CCGGCTCGATGAATCCGTAGTGAAACTCGAGTTTCACTACGGATTCATCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010231
FMO1 MISSION shRNA shRNA Plasmid DNA
flavin containing monooxygenase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010231.2-2178s1c1
Sequence:CCGGCCAGAGAATACTCTGAGCATTCTCGAGAATGCTCAGAGTATTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010231.2-1277s1c1
Sequence:CCGGCCCATTGACATCATCGTCTTTCTCGAGAAAGACGATGATGTCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010231.2-1327s1c1
Sequence:CCGGCCTCGATGAATCCGTAGTGAACTCGAGTTCACTACGGATTCATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010231.2-539s1c1
Sequence:CCGGCCAGAAGACTATCCAAACTTTCTCGAGAAAGTTTGGATAGTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010231.2-1328s1c1
Sequence:CCGGCTCGATGAATCCGTAGTGAAACTCGAGTTTCACTACGGATTCATCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010231
FMO1 MISSION shRNA Lentiviral Transduction Particles
flavin containing monooxygenase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010231.2-2178s1c1
Sequence:CCGGCCAGAGAATACTCTGAGCATTCTCGAGAATGCTCAGAGTATTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010231.2-1277s1c1
Sequence:CCGGCCCATTGACATCATCGTCTTTCTCGAGAAAGACGATGATGTCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010231.2-1327s1c1
Sequence:CCGGCCTCGATGAATCCGTAGTGAACTCGAGTTCACTACGGATTCATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010231.2-539s1c1
Sequence:CCGGCCAGAAGACTATCCAAACTTTCTCGAGAAAGTTTGGATAGTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010231.2-1328s1c1
Sequence:CCGGCTCGATGAATCCGTAGTGAAACTCGAGTTTCACTACGGATTCATCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)