EMAIL THIS PAGE TO A FRIEND

FMO2

flavin containing monooxygenase 2 (non-functional)

Synonyms: FMO 1B1 FMO 2 FMO1B1
UniProtKB ID: Q99518, Q5EBX4, Q86U73, Q9BRX1
Gene ID:
Human(2327) Summary: The flavin-containing monooxygenases are NADPH-dependent enzymes that catalyze the oxidation of many drugs and xenobiotics. In most mammals, there is a flavin-containing monooxygenase that catalyzes the N-oxidation of some primary alkylamines through an N-hydroxylamine intermediate. However, in some human populations, this enzyme is truncated and likely degraded rapidly. The protein encoded by this gene represents the truncated form and apparently has no catalytic activity. A functional allele found in African Americans has been reported, but no sequence evidence has been deposited to support the finding. This gene is found in a cluster with the FMO1, FMO3, and FMO4 genes on chromosome 1. [provided by RefSeq, Jun 2013]
Mouse(55990) flavin containing monooxygenase 2
Rat(246245) flavin containing monooxygenase 2
domestic guinea pig(100725320) flavin containing monooxygenase 2 (non-functional)
domestic guinea pig(100135520) flavin containing monooxygenase 2
naked mole-rat(101710590) flavin containing monooxygenase 2 (non-functional)
sheep(101104842) flavin containing monooxygenase 2 (non-functional)
domestic cat(101086867) flavin containing monooxygenase 2 (non-functional)
cow(504401) flavin containing monooxygenase 2 (non-functional)
dog(480076) flavin containing monooxygenase 2 (non-functional)
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001460 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015031 MISSION® esiRNA esiRNA targeting human FMO2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001460 Rosetta Predictions human pricing
NM_144737 Rosetta Predictions rat pricing
NM_018881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237875 predicted 949
2 SASI_Hs01_00237876 predicted 846
3 SASI_Hs01_00237877 predicted 1405
4 SASI_Hs01_00237878 predicted 348
5 SASI_Hs02_00331899 predicted 317
6 SASI_Hs01_00237880 predicted 702
7 SASI_Hs01_00237881 predicted 706
8 SASI_Hs01_00237882 predicted 1124
9 SASI_Hs01_00237883 predicted 252
10 SASI_Hs01_00237884 predicted 725
11 SASI_Hs01_00237879 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082577 predicted 651
2 SASI_Rn01_00082578 predicted 917
3 SASI_Rn01_00082579 predicted 745
4 SASI_Rn01_00082580 predicted 994
5 SASI_Rn01_00082581 predicted 250
6 SASI_Rn01_00082582 predicted 403
7 SASI_Rn01_00082583 predicted 1369
8 SASI_Rn01_00082584 predicted 376
9 SASI_Rn01_00082585 predicted 323
10 SASI_Rn01_00082586 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059872 predicted 297
2 SASI_Mm01_00059868 predicted 196
3 SASI_Mm01_00059869 predicted 275
4 SASI_Mm01_00059870 predicted 506
5 SASI_Mm01_00059871 predicted 329
6 SASI_Mm02_00324286 predicted 353
7 SASI_Mm02_00324287 predicted 1437
8 SASI_Mm01_00059873 predicted 1327
9 SASI_Mm01_00059875 predicted 630
10 SASI_Mm01_00059874 predicted 683
11 SASI_Mm01_00059866 predicted 358
12 SASI_Mm01_00059867 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018881
FMO2 MISSION shRNA Bacterial Glycerol Stock
flavin containing monooxygenase 2 (non-functional)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018881.2-3196s1c1
Sequence:CCGGGCCAGGATACTGAAGGTTTAACTCGAGTTAAACCTTCAGTATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018881.2-457s1c1
Sequence:CCGGGCACTGTCTTTGACGCTGTTACTCGAGTAACAGCGTCAAAGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018881.2-1614s1c1
Sequence:CCGGGCTGTTGTTCTGGCCTTCTTTCTCGAGAAAGAAGGCCAGAACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018881.2-214s1c1
Sequence:CCGGGCTCTGTCATTACCAACACTACTCGAGTAGTGTTGGTAATGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018881.2-1386s1c1
Sequence:CCGGCCAGATTTCGTCTCTCTCTTTCTCGAGAAAGAGAGAGACGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018881
FMO2 MISSION shRNA shRNA Plasmid DNA
flavin containing monooxygenase 2 (non-functional)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018881.2-3196s1c1
Sequence:CCGGGCCAGGATACTGAAGGTTTAACTCGAGTTAAACCTTCAGTATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018881.2-457s1c1
Sequence:CCGGGCACTGTCTTTGACGCTGTTACTCGAGTAACAGCGTCAAAGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018881.2-1614s1c1
Sequence:CCGGGCTGTTGTTCTGGCCTTCTTTCTCGAGAAAGAAGGCCAGAACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018881.2-214s1c1
Sequence:CCGGGCTCTGTCATTACCAACACTACTCGAGTAGTGTTGGTAATGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018881.2-1386s1c1
Sequence:CCGGCCAGATTTCGTCTCTCTCTTTCTCGAGAAAGAGAGAGACGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018881
FMO2 MISSION shRNA Lentiviral Transduction Particles
flavin containing monooxygenase 2 (non-functional)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018881.2-3196s1c1
Sequence:CCGGGCCAGGATACTGAAGGTTTAACTCGAGTTAAACCTTCAGTATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018881.2-457s1c1
Sequence:CCGGGCACTGTCTTTGACGCTGTTACTCGAGTAACAGCGTCAAAGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018881.2-1614s1c1
Sequence:CCGGGCTGTTGTTCTGGCCTTCTTTCTCGAGAAAGAAGGCCAGAACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018881.2-214s1c1
Sequence:CCGGGCTCTGTCATTACCAACACTACTCGAGTAGTGTTGGTAATGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018881.2-1386s1c1
Sequence:CCGGCCAGATTTCGTCTCTCTCTTTCTCGAGAAAGAGAGAGACGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001460
FMO2 MISSION shRNA Bacterial Glycerol Stock
flavin containing monooxygenase 2 (non-functional)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-260s1c1
Sequence:CCGGCCTGTTTCAGTGACTTTCCAACTCGAGTTGGAAAGTCACTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-1414s1c1
Sequence:CCGGCTCTTGTTCAAAGATCCTAAACTCGAGTTTAGGATCTTTGAACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-1071s1c1
Sequence:CCGGCCTTGAAGATTCACTCGTTAACTCGAGTTAACGAGTGAATCTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-209s1c1
Sequence:CCGGGCCGAGCAAGTATCTATCAATCTCGAGATTGATAGATACTTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-1335s1c1
Sequence:CCGGCCAGACGTTGCAGACCAATTACTCGAGTAATTGGTCTGCAACGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-1032s1c1
Sequence:CCGGGCTCACAGAAACTTCTGCCATCTCGAGATGGCAGAAGTTTCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001460.2-1587s1c1
Sequence:CCGGCCAGAAACAAAGAATACTGAACTCGAGTTCAGTATTCTTTGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-1471s1c1
Sequence:CCGGCTCTTGTTCAAAGATCCTAAACTCGAGTTTAGGATCTTTGAACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001460.2-3733s1c1
Sequence:CCGGGCCACACTCATTCATTTATTTCTCGAGAAATAAATGAATGAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.2-275s1c1
Sequence:CCGGGTATCTATCAATCTGTCGTTACTCGAGTAACGACAGATTGATAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-958s1c1
Sequence:CCGGGAACCTGTACTAAATGATGATCTCGAGATCATCATTTAGTACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.2-1128s1c1
Sequence:CCGGCCTTGAAGATTCACTCGTTAACTCGAGTTAACGAGTGAATCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001460.2-4618s1c1
Sequence:CCGGCCCAAAGTTATGTGTTTGAAACTCGAGTTTCAAACACATAACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-330s1c1
Sequence:CCGGCTTTCCAATGCCTGAAGATTTCTCGAGAAATCTTCAGGCATTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-715s1c1
Sequence:CCGGGCTGTTGAGCTGAGTAAGAATCTCGAGATTCTTACTCAGCTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001460
FMO2 MISSION shRNA shRNA Plasmid DNA
flavin containing monooxygenase 2 (non-functional)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-260s1c1
Sequence:CCGGCCTGTTTCAGTGACTTTCCAACTCGAGTTGGAAAGTCACTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-1414s1c1
Sequence:CCGGCTCTTGTTCAAAGATCCTAAACTCGAGTTTAGGATCTTTGAACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-1071s1c1
Sequence:CCGGCCTTGAAGATTCACTCGTTAACTCGAGTTAACGAGTGAATCTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-209s1c1
Sequence:CCGGGCCGAGCAAGTATCTATCAATCTCGAGATTGATAGATACTTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-1335s1c1
Sequence:CCGGCCAGACGTTGCAGACCAATTACTCGAGTAATTGGTCTGCAACGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-1032s1c1
Sequence:CCGGGCTCACAGAAACTTCTGCCATCTCGAGATGGCAGAAGTTTCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001460.2-1587s1c1
Sequence:CCGGCCAGAAACAAAGAATACTGAACTCGAGTTCAGTATTCTTTGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-1471s1c1
Sequence:CCGGCTCTTGTTCAAAGATCCTAAACTCGAGTTTAGGATCTTTGAACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001460.2-3733s1c1
Sequence:CCGGGCCACACTCATTCATTTATTTCTCGAGAAATAAATGAATGAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.2-275s1c1
Sequence:CCGGGTATCTATCAATCTGTCGTTACTCGAGTAACGACAGATTGATAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-958s1c1
Sequence:CCGGGAACCTGTACTAAATGATGATCTCGAGATCATCATTTAGTACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.2-1128s1c1
Sequence:CCGGCCTTGAAGATTCACTCGTTAACTCGAGTTAACGAGTGAATCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001460.2-4618s1c1
Sequence:CCGGCCCAAAGTTATGTGTTTGAAACTCGAGTTTCAAACACATAACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-330s1c1
Sequence:CCGGCTTTCCAATGCCTGAAGATTTCTCGAGAAATCTTCAGGCATTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-715s1c1
Sequence:CCGGGCTGTTGAGCTGAGTAAGAATCTCGAGATTCTTACTCAGCTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001460
FMO2 MISSION shRNA Lentiviral Transduction Particles
flavin containing monooxygenase 2 (non-functional)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-260s1c1
Sequence:CCGGCCTGTTTCAGTGACTTTCCAACTCGAGTTGGAAAGTCACTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-1414s1c1
Sequence:CCGGCTCTTGTTCAAAGATCCTAAACTCGAGTTTAGGATCTTTGAACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-1071s1c1
Sequence:CCGGCCTTGAAGATTCACTCGTTAACTCGAGTTAACGAGTGAATCTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-209s1c1
Sequence:CCGGGCCGAGCAAGTATCTATCAATCTCGAGATTGATAGATACTTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.1-1335s1c1
Sequence:CCGGCCAGACGTTGCAGACCAATTACTCGAGTAATTGGTCTGCAACGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-1032s1c1
Sequence:CCGGGCTCACAGAAACTTCTGCCATCTCGAGATGGCAGAAGTTTCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001460.2-1587s1c1
Sequence:CCGGCCAGAAACAAAGAATACTGAACTCGAGTTCAGTATTCTTTGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-1471s1c1
Sequence:CCGGCTCTTGTTCAAAGATCCTAAACTCGAGTTTAGGATCTTTGAACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001460.2-3733s1c1
Sequence:CCGGGCCACACTCATTCATTTATTTCTCGAGAAATAAATGAATGAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.2-275s1c1
Sequence:CCGGGTATCTATCAATCTGTCGTTACTCGAGTAACGACAGATTGATAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-958s1c1
Sequence:CCGGGAACCTGTACTAAATGATGATCTCGAGATCATCATTTAGTACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001460.2-1128s1c1
Sequence:CCGGCCTTGAAGATTCACTCGTTAACTCGAGTTAACGAGTGAATCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001460.2-4618s1c1
Sequence:CCGGCCCAAAGTTATGTGTTTGAAACTCGAGTTTCAAACACATAACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-330s1c1
Sequence:CCGGCTTTCCAATGCCTGAAGATTTCTCGAGAAATCTTCAGGCATTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001460.2-715s1c1
Sequence:CCGGGCTGTTGAGCTGAGTAAGAATCTCGAGATTCTTACTCAGCTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks