EMAIL THIS PAGE TO A FRIEND

FMO3

flavin containing monooxygenase 3

82 Gene Product Result for
Synonyms: FMOII TMAU dJ127D3.1
UniProtKB ID: P31513, B2R816, Q14854, Q8N5N5
Gene ID:
Human(2328) Summary: Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Aug 2009]
Mouse(14262) flavin containing monooxygenase 3
Rat(84493) flavin containing monooxygenase 3
dog(403603) flavin containing monooxygenase 3
domestic cat(101089484) flavin containing monooxygenase 3
cow(281167) flavin containing monooxygenase 3
sheep(101104165) flavin containing monooxygenase 3
Domestic Rabbit(100009065) flavin containing monooxygenase 3
naked mole-rat(101711325) flavin containing monooxygenase 3
domestic guinea pig(100727520) flavin containing monooxygenase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001002294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002294 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002294 Rosetta Predictions human pricing
NM_006894 Rosetta Predictions human pricing
NM_053433 Rosetta Predictions rat pricing
NM_008030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304183 predicted 971
2 SASI_Hs01_00191416 predicted 1264
3 SASI_Hs02_00304184 predicted 421
4 SASI_Hs01_00191418 predicted 339
5 SASI_Hs01_00191420 predicted 404
6 SASI_Hs02_00304185 predicted 1097
7 SASI_Hs01_00191421 predicted 1184
8 SASI_Hs01_00191422 predicted 875
9 SASI_Hs02_00304186 predicted 1273
10 SASI_Hs01_00191424 predicted 1601
11 SASI_Hs01_00191417 predicted 1462
12 SASI_Hs01_00191419 predicted 932
13 SASI_Hs01_00191423 predicted 1643
14 SASI_Hs01_00191425 predicted 1706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342568 predicted 960
2 SASI_Hs01_00208243 predicted 1248
3 SASI_Hs02_00342569 predicted 402
4 SASI_Hs01_00208245 predicted 326
5 SASI_Hs01_00208247 predicted 388
6 SASI_Hs02_00342570 predicted 1080
7 SASI_Hs01_00208248 predicted 1170
8 SASI_Hs01_00208249 predicted 854
9 SASI_Hs02_00342571 predicted 1249
10 SASI_Hs01_00208251 predicted 1585
11 SASI_Hs01_00208244 predicted 1443
12 SASI_Hs01_00208246 predicted 908
13 SASI_Hs01_00208250 predicted 1628
14 SASI_Hs01_00208252 predicted 1692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102458 predicted 742
2 SASI_Rn01_00102459 predicted 1553
3 SASI_Rn02_00266001 predicted 936
4 SASI_Rn01_00102460 predicted 651
5 SASI_Rn01_00102461 predicted 1004
6 SASI_Rn01_00102462 predicted 525
7 SASI_Rn01_00102463 predicted 590
8 SASI_Rn01_00102464 predicted 1041
9 SASI_Rn02_00266002 predicted 573
10 SASI_Rn01_00102465 predicted 1027
11 SASI_Rn01_00102466 predicted 1673
12 SASI_Rn01_00102467 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174931 predicted 449
2 SASI_Mm01_00174932 predicted 924
3 SASI_Mm01_00174933 predicted 802
4 SASI_Mm01_00174934 predicted 837
5 SASI_Mm02_00312986 predicted 1319
6 SASI_Mm01_00174935 predicted 389
7 SASI_Mm01_00174937 predicted 344
8 SASI_Mm01_00174938 predicted 355
9 SASI_Mm01_00174939 predicted 610
10 SASI_Mm01_00174940 predicted 1536
11 SASI_Mm01_00174936 predicted 1371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008030
FMO3 MISSION shRNA Bacterial Glycerol Stock
flavin containing monooxygenase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008030.1-1684s1c1
Sequence:CCGGCCAGACAAGAACTTTGCTATTCTCGAGAATAGCAAAGTTCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008030.1-1234s1c1
Sequence:CCGGGCCTTCTGTAAACGACATGATCTCGAGATCATGTCGTTTACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008030.1-811s1c1
Sequence:CCGGGCAGATGAATGCCAGATTCAACTCGAGTTGAATCTGGCATTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008030.1-1314s1c1
Sequence:CCGGTCCAGACAGATTACATTGTTTCTCGAGAAACAATGTAATCTGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008030.1-1315s1c1
Sequence:CCGGCCAGACAGATTACATTGTTTACTCGAGTAAACAATGTAATCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008030
FMO3 MISSION shRNA shRNA Plasmid DNA
flavin containing monooxygenase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008030.1-1684s1c1
Sequence:CCGGCCAGACAAGAACTTTGCTATTCTCGAGAATAGCAAAGTTCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008030.1-1234s1c1
Sequence:CCGGGCCTTCTGTAAACGACATGATCTCGAGATCATGTCGTTTACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008030.1-811s1c1
Sequence:CCGGGCAGATGAATGCCAGATTCAACTCGAGTTGAATCTGGCATTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008030.1-1314s1c1
Sequence:CCGGTCCAGACAGATTACATTGTTTCTCGAGAAACAATGTAATCTGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008030.1-1315s1c1
Sequence:CCGGCCAGACAGATTACATTGTTTACTCGAGTAAACAATGTAATCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008030
FMO3 MISSION shRNA Lentiviral Transduction Particles
flavin containing monooxygenase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008030.1-1684s1c1
Sequence:CCGGCCAGACAAGAACTTTGCTATTCTCGAGAATAGCAAAGTTCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008030.1-1234s1c1
Sequence:CCGGGCCTTCTGTAAACGACATGATCTCGAGATCATGTCGTTTACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008030.1-811s1c1
Sequence:CCGGGCAGATGAATGCCAGATTCAACTCGAGTTGAATCTGGCATTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008030.1-1314s1c1
Sequence:CCGGTCCAGACAGATTACATTGTTTCTCGAGAAACAATGTAATCTGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008030.1-1315s1c1
Sequence:CCGGCCAGACAGATTACATTGTTTACTCGAGTAAACAATGTAATCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002294
FMO3 MISSION shRNA Bacterial Glycerol Stock
flavin containing monooxygenase 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002294.1-1654s1c1
Sequence:CCGGCCTATTCTGTTAATCGCTGTTCTCGAGAACAGCGATTAACAGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002294.1-1127s1c1
Sequence:CCGGGCAGAAACAATGAGATCATTTCTCGAGAAATGATCTCATTGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002294.1-503s1c1
Sequence:CCGGCGGCTGTCTTTGATGCTGTAACTCGAGTTACAGCATCAAAGACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002294.1-390s1c1
Sequence:CCGGCCTCCTGAAGTACATACAATTCTCGAGAATTGTATGTACTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002294.1-1848s1c1
Sequence:CCGGGCTCTGAAATAGCCACTTTAACTCGAGTTAAAGTGGCTATTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002294.2-622s21c1
Sequence:CCGGTTCCACAGCAGGGACTATAAACTCGAGTTTATAGTCCCTGCTGTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002294.2-990s21c1
Sequence:CCGGGTGTGGCATTGTGTCCGTAAACTCGAGTTTACGGACACAATGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002294.2-1903s21c1
Sequence:CCGGTTAAGAGAGCACTAATCATTTCTCGAGAAATGATTAGTGCTCTCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002294.2-1699s21c1
Sequence:CCGGGTGTTGACCTAATCATCATTTCTCGAGAAATGATGATTAGGTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002294
FMO3 MISSION shRNA shRNA Plasmid DNA
flavin containing monooxygenase 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002294.1-1654s1c1
Sequence:CCGGCCTATTCTGTTAATCGCTGTTCTCGAGAACAGCGATTAACAGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002294.1-1127s1c1
Sequence:CCGGGCAGAAACAATGAGATCATTTCTCGAGAAATGATCTCATTGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002294.1-503s1c1
Sequence:CCGGCGGCTGTCTTTGATGCTGTAACTCGAGTTACAGCATCAAAGACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002294.1-390s1c1
Sequence:CCGGCCTCCTGAAGTACATACAATTCTCGAGAATTGTATGTACTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002294.1-1848s1c1
Sequence:CCGGGCTCTGAAATAGCCACTTTAACTCGAGTTAAAGTGGCTATTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002294.2-622s21c1
Sequence:CCGGTTCCACAGCAGGGACTATAAACTCGAGTTTATAGTCCCTGCTGTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002294.2-990s21c1
Sequence:CCGGGTGTGGCATTGTGTCCGTAAACTCGAGTTTACGGACACAATGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002294.2-1903s21c1
Sequence:CCGGTTAAGAGAGCACTAATCATTTCTCGAGAAATGATTAGTGCTCTCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002294.2-1699s21c1
Sequence:CCGGGTGTTGACCTAATCATCATTTCTCGAGAAATGATGATTAGGTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002294
FMO3 MISSION shRNA Lentiviral Transduction Particles
flavin containing monooxygenase 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002294.1-1654s1c1
Sequence:CCGGCCTATTCTGTTAATCGCTGTTCTCGAGAACAGCGATTAACAGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002294.1-1127s1c1
Sequence:CCGGGCAGAAACAATGAGATCATTTCTCGAGAAATGATCTCATTGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002294.1-503s1c1
Sequence:CCGGCGGCTGTCTTTGATGCTGTAACTCGAGTTACAGCATCAAAGACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002294.1-390s1c1
Sequence:CCGGCCTCCTGAAGTACATACAATTCTCGAGAATTGTATGTACTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002294.1-1848s1c1
Sequence:CCGGGCTCTGAAATAGCCACTTTAACTCGAGTTAAAGTGGCTATTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002294.2-622s21c1
Sequence:CCGGTTCCACAGCAGGGACTATAAACTCGAGTTTATAGTCCCTGCTGTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002294.2-990s21c1
Sequence:CCGGGTGTGGCATTGTGTCCGTAAACTCGAGTTTACGGACACAATGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002294.2-1903s21c1
Sequence:CCGGTTAAGAGAGCACTAATCATTTCTCGAGAAATGATTAGTGCTCTCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002294.2-1699s21c1
Sequence:CCGGGTGTTGACCTAATCATCATTTCTCGAGAAATGATGATTAGGTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks