EMAIL THIS PAGE TO A FRIEND

FMO4

flavin containing monooxygenase 4

139 Gene Product Result for
Synonyms: FMO2
UniProtKB ID: P31512, Q53XR0
Gene ID:
Human(2329) Summary: Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jul 2008]
Mouse(226564) flavin containing monooxygenase 4
Rat(246247) flavin containing monooxygenase 4
domestic guinea pig(100735396) flavin containing monooxygenase 4
naked mole-rat(101707236) flavin containing monooxygenase 4
sheep(101105344) flavin containing monooxygenase 4
Domestic Rabbit(100009119) flavin containing monooxygenase 4
Domestic Rabbit(100009582) flavin containing monooxygenase 4
chicken(770587) flavin containing monooxygenase 4
domestic cat(101089734) flavin containing monooxygenase 4
cow(539356) flavin containing monooxygenase 4
Horse(100052080) flavin containing monooxygenase 4
dog(490345) flavin containing monooxygenase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002022 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002022 Rosetta Predictions human pricing
NM_144561 Rosetta Predictions rat pricing
NM_144562 Rosetta Predictions rat pricing
NM_144878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145573 predicted 410
2 SASI_Hs01_00145574 predicted 715
3 SASI_Hs01_00145575 predicted 480
4 SASI_Hs01_00145576 predicted 754
5 SASI_Hs01_00145577 predicted 1608
6 SASI_Hs01_00145579 predicted 1386
7 SASI_Hs02_00333039 predicted 1180
8 SASI_Hs02_00333040 predicted 1323
9 SASI_Hs02_00333041 predicted 994
10 SASI_Hs01_00145581 predicted 1609
11 SASI_Hs01_00145578 predicted 401
12 SASI_Hs01_00145580 predicted 393
13 SASI_Hs01_00145582 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268607 predicted 463
2 SASI_Rn01_00082025 predicted 1425
3 SASI_Rn01_00082026 predicted 1035
4 SASI_Rn02_00268608 predicted 474
5 SASI_Rn02_00268609 predicted 646
6 SASI_Rn02_00268610 predicted 529
7 SASI_Rn01_00082028 predicted 934
8 SASI_Rn01_00082029 predicted 1398
9 SASI_Rn01_00082030 predicted 1349
10 SASI_Rn01_00082032 predicted 1019
11 SASI_Rn01_00082027 predicted 1422
12 SASI_Rn01_00082031 predicted 992
13 SASI_Rn01_00082033 predicted 1116
14 SASI_Rn01_00082034 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031436 predicted 1037
2 SASI_Rn01_00031437 predicted 641
3 SASI_Rn01_00031438 predicted 1024
4 SASI_Rn01_00031439 predicted 529
5 SASI_Rn01_00031440 predicted 997
6 SASI_Rn01_00031441 predicted 957
7 SASI_Rn01_00031442 predicted 589
8 SASI_Rn01_00031443 predicted 624
9 SASI_Rn01_00031444 predicted 719
10 SASI_Rn01_00031445 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097235 predicted 1134
2 SASI_Mm01_00097236 predicted 231
3 SASI_Mm01_00097237 predicted 738
4 SASI_Mm01_00097238 predicted 1068
5 SASI_Mm01_00097240 predicted 758
6 SASI_Mm01_00097241 predicted 815
7 SASI_Mm01_00097242 predicted 466
8 SASI_Mm02_00340323 predicted 620
9 SASI_Mm01_00097243 predicted 1198
10 SASI_Mm01_00097244 predicted 1114
11 SASI_Mm01_00097239 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002022
VALIDATED
FMO4 MISSION shRNA Bacterial Glycerol Stock
flavin containing monooxygenase 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002022.1-1012s21c1
Sequence:CCGGTCATGAGGATTATGGATTAAGCTCGAGCTTAATCCATAATCCTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002022.1-364s21c1
Sequence:CCGGTGGGATGACCAGGGTCTATAACTCGAGTTATAGACCCTGGTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002022.1-1319s21c1
Sequence:CCGGATCGGCCTTATCGGCCTTAAACTCGAGTTTAAGGCCGATAAGGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002022.1-1912s21c1
Sequence:CCGGGTTACACCAAGTCATGCTAATCTCGAGATTAGCATGACTTGGTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002022.1-439s21c1
Sequence:CCGGCCACGAAGATTATCCTAATTTCTCGAGAAATTAGGATAATCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002022.1-1839s1c1
Sequence:CCGGGAGATAAACTACAGGACAGAACTCGAGTTCTGTCCTGTAGTTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002022.1-1330s1c1
Sequence:CCGGCGGCCTTAAAGGATCCATCTTCTCGAGAAGATGGATCCTTTAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002022.1-1688s1c1
Sequence:CCGGGACAGAACATTGAAACCTTTACTCGAGTAAAGGTTTCAATGTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002022.1-1119s1c1
Sequence:CCGGGCGTGATTGAATTTACAGAAACTCGAGTTTCTGTAAATTCAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002022.1-439s1c1
Sequence:CCGGCCACGAAGATTATCCTAATTTCTCGAGAAATTAGGATAATCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002022
VALIDATED
FMO4 MISSION shRNA shRNA Plasmid DNA
flavin containing monooxygenase 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002022.1-1012s21c1
Sequence:CCGGTCATGAGGATTATGGATTAAGCTCGAGCTTAATCCATAATCCTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002022.1-364s21c1
Sequence:CCGGTGGGATGACCAGGGTCTATAACTCGAGTTATAGACCCTGGTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002022.1-1319s21c1
Sequence:CCGGATCGGCCTTATCGGCCTTAAACTCGAGTTTAAGGCCGATAAGGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002022.1-1912s21c1
Sequence:CCGGGTTACACCAAGTCATGCTAATCTCGAGATTAGCATGACTTGGTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002022.1-439s21c1
Sequence:CCGGCCACGAAGATTATCCTAATTTCTCGAGAAATTAGGATAATCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002022.1-1839s1c1
Sequence:CCGGGAGATAAACTACAGGACAGAACTCGAGTTCTGTCCTGTAGTTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002022.1-1330s1c1
Sequence:CCGGCGGCCTTAAAGGATCCATCTTCTCGAGAAGATGGATCCTTTAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002022.1-1688s1c1
Sequence:CCGGGACAGAACATTGAAACCTTTACTCGAGTAAAGGTTTCAATGTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002022.1-1119s1c1
Sequence:CCGGGCGTGATTGAATTTACAGAAACTCGAGTTTCTGTAAATTCAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002022.1-439s1c1
Sequence:CCGGCCACGAAGATTATCCTAATTTCTCGAGAAATTAGGATAATCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002022
VALIDATED
FMO4 MISSION shRNA Lentiviral Transduction Particles
flavin containing monooxygenase 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002022.1-1012s21c1
Sequence:CCGGTCATGAGGATTATGGATTAAGCTCGAGCTTAATCCATAATCCTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002022.1-364s21c1
Sequence:CCGGTGGGATGACCAGGGTCTATAACTCGAGTTATAGACCCTGGTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002022.1-1319s21c1
Sequence:CCGGATCGGCCTTATCGGCCTTAAACTCGAGTTTAAGGCCGATAAGGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002022.1-1912s21c1
Sequence:CCGGGTTACACCAAGTCATGCTAATCTCGAGATTAGCATGACTTGGTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002022.1-439s21c1
Sequence:CCGGCCACGAAGATTATCCTAATTTCTCGAGAAATTAGGATAATCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002022.1-1839s1c1
Sequence:CCGGGAGATAAACTACAGGACAGAACTCGAGTTCTGTCCTGTAGTTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002022.1-1330s1c1
Sequence:CCGGCGGCCTTAAAGGATCCATCTTCTCGAGAAGATGGATCCTTTAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002022.1-1688s1c1
Sequence:CCGGGACAGAACATTGAAACCTTTACTCGAGTAAAGGTTTCAATGTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002022.1-1119s1c1
Sequence:CCGGGCGTGATTGAATTTACAGAAACTCGAGTTTCTGTAAATTCAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002022.1-439s1c1
Sequence:CCGGCCACGAAGATTATCCTAATTTCTCGAGAAATTAGGATAATCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144878
FMO4 MISSION shRNA Bacterial Glycerol Stock
flavin containing monooxygenase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-329s1c1
Sequence:CCGGGCTGAGATATATTCGGTTTAACTCGAGTTAAACCGAATATATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-1108s1c1
Sequence:CCGGAGAGAGCAACATTAGCCATTACTCGAGTAATGGCTAATGTTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-518s1c1
Sequence:CCGGCCATAAGTTTAAAGGACAGATCTCGAGATCTGTCCTTTAAACTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-204s1c1
Sequence:CCGGGTGACAAATGTCTGCAAAGAACTCGAGTTCTTTGCAGACATTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-1055s1c1
Sequence:CCGGCCTTTGTACAAAGAAGATCATCTCGAGATGATCTTCTTTGTACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144878
FMO4 MISSION shRNA shRNA Plasmid DNA
flavin containing monooxygenase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-329s1c1
Sequence:CCGGGCTGAGATATATTCGGTTTAACTCGAGTTAAACCGAATATATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-1108s1c1
Sequence:CCGGAGAGAGCAACATTAGCCATTACTCGAGTAATGGCTAATGTTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-518s1c1
Sequence:CCGGCCATAAGTTTAAAGGACAGATCTCGAGATCTGTCCTTTAAACTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-204s1c1
Sequence:CCGGGTGACAAATGTCTGCAAAGAACTCGAGTTCTTTGCAGACATTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-1055s1c1
Sequence:CCGGCCTTTGTACAAAGAAGATCATCTCGAGATGATCTTCTTTGTACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144878
FMO4 MISSION shRNA Lentiviral Transduction Particles
flavin containing monooxygenase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-329s1c1
Sequence:CCGGGCTGAGATATATTCGGTTTAACTCGAGTTAAACCGAATATATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-1108s1c1
Sequence:CCGGAGAGAGCAACATTAGCCATTACTCGAGTAATGGCTAATGTTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-518s1c1
Sequence:CCGGCCATAAGTTTAAAGGACAGATCTCGAGATCTGTCCTTTAAACTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-204s1c1
Sequence:CCGGGTGACAAATGTCTGCAAAGAACTCGAGTTCTTTGCAGACATTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144878.1-1055s1c1
Sequence:CCGGCCTTTGTACAAAGAAGATCATCTCGAGATGATCTTCTTTGTACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks