EMAIL THIS PAGE TO A FRIEND

FMO5

flavin containing monooxygenase 5

63 Gene Product Result for
UniProtKB ID: P49326, B2RBG1, C9JJD1, Q8IV22
Gene ID:
Human(2330) Summary: Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Mouse(14263) flavin containing monooxygenase 5
Rat(246248) flavin containing monooxygenase 5
Zebrafish(794311) flavin containing monooxygenase 5
cow(788719) flavin containing monooxygenase 5
Horse(100065455) flavin containing monooxygenase 5
domestic cat(101092533) flavin containing monooxygenase 5
dog(475819) flavin containing monooxygenase 5
chicken(100857694) flavin containing monooxygenase 5
sheep(101113713) flavin containing monooxygenase 5
Domestic Rabbit(100009064) flavin containing monooxygenase 5
domestic guinea pig(100135521) flavin containing monooxygenase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010232 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010232 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010232 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001461 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001461 Rosetta Predictions human pricing
NM_144739 Rosetta Predictions rat pricing
XM_579668 Rosetta Predictions rat pricing
NM_010232 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331900 predicted 283
2 SASI_Hs01_00018594 predicted 1666
3 SASI_Hs02_00331901 predicted 1617
4 SASI_Hs01_00018597 predicted 1313
5 SASI_Hs01_00018598 predicted 1262
6 SASI_Hs01_00018599 predicted 528
7 SASI_Hs01_00018600 predicted 1622
8 SASI_Hs01_00018601 predicted 813
9 SASI_Hs01_00018602 predicted 639
10 SASI_Hs01_00018603 predicted 302
11 SASI_Hs01_00018595 predicted 1078
12 SASI_Hs01_00018596 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080094 predicted 482
2 SASI_Rn01_00080095 predicted 413
3 SASI_Rn02_00268621 predicted 1045
4 SASI_Rn01_00080096 predicted 1437
5 SASI_Rn01_00080097 predicted 1055
6 SASI_Rn01_00080099 predicted 429
7 SASI_Rn01_00080100 predicted 615
8 SASI_Rn01_00080101 predicted 1012
9 SASI_Rn01_00080102 predicted 1629
10 SASI_Rn01_00080103 predicted 1812
11 SASI_Rn01_00080098 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129295 predicted 1263
2 SASI_Rn01_00129296 predicted 1712
3 SASI_Rn01_00129297 predicted 1437
4 SASI_Rn01_00129298 predicted 1582
5 SASI_Rn01_00129299 predicted 1392
6 SASI_Rn01_00129300 predicted 1243
7 SASI_Rn01_00129301 predicted 1518
8 SASI_Rn01_00129302 predicted 1637
9 SASI_Rn01_00129303 predicted 1334
10 SASI_Rn01_00129304 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185374 predicted 1174
2 SASI_Mm01_00185375 predicted 306
3 SASI_Mm01_00185376 predicted 866
4 SASI_Mm02_00318090 predicted 1209
5 SASI_Mm01_00185377 predicted 1271
6 SASI_Mm01_00185378 predicted 1372
7 SASI_Mm01_00185379 predicted 1186
8 SASI_Mm01_00185380 predicted 594
9 SASI_Mm01_00185381 predicted 986
10 SASI_Mm01_00185382 predicted 861
11 SASI_Mm01_00185383 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010232
FMO5 MISSION shRNA Bacterial Glycerol Stock
flavin containing monooxygenase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010232.3-2154s1c1
Sequence:CCGGGCTTCCATTATCAAGCGCATACTCGAGTATGCGCTTGATAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010232.3-789s1c1
Sequence:CCGGGCTACTCTCTTCTCGGATTATCTCGAGATAATCCGAGAAGAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010232.3-1079s1c1
Sequence:CCGGGCTACAGCTTTGCCTTTCCTTCTCGAGAAGGAAAGGCAAAGCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010232.3-351s1c1
Sequence:CCGGCCTAGAGTATTTCAGGATGTACTCGAGTACATCCTGAAATACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010232.3-1284s1c1
Sequence:CCGGGCCCTCACAAAGTGAAATGATCTCGAGATCATTTCACTTTGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010232
FMO5 MISSION shRNA shRNA Plasmid DNA
flavin containing monooxygenase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010232.3-2154s1c1
Sequence:CCGGGCTTCCATTATCAAGCGCATACTCGAGTATGCGCTTGATAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010232.3-789s1c1
Sequence:CCGGGCTACTCTCTTCTCGGATTATCTCGAGATAATCCGAGAAGAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010232.3-1079s1c1
Sequence:CCGGGCTACAGCTTTGCCTTTCCTTCTCGAGAAGGAAAGGCAAAGCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010232.3-351s1c1
Sequence:CCGGCCTAGAGTATTTCAGGATGTACTCGAGTACATCCTGAAATACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010232.3-1284s1c1
Sequence:CCGGGCCCTCACAAAGTGAAATGATCTCGAGATCATTTCACTTTGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010232
FMO5 MISSION shRNA Lentiviral Transduction Particles
flavin containing monooxygenase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010232.3-2154s1c1
Sequence:CCGGGCTTCCATTATCAAGCGCATACTCGAGTATGCGCTTGATAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010232.3-789s1c1
Sequence:CCGGGCTACTCTCTTCTCGGATTATCTCGAGATAATCCGAGAAGAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010232.3-1079s1c1
Sequence:CCGGGCTACAGCTTTGCCTTTCCTTCTCGAGAAGGAAAGGCAAAGCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010232.3-351s1c1
Sequence:CCGGCCTAGAGTATTTCAGGATGTACTCGAGTACATCCTGAAATACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010232.3-1284s1c1
Sequence:CCGGGCCCTCACAAAGTGAAATGATCTCGAGATCATTTCACTTTGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001461
FMO5 MISSION shRNA Bacterial Glycerol Stock
flavin containing monooxygenase 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-1619s1c1
Sequence:CCGGCAATGACAATAGGCAAGTTTACTCGAGTAAACTTGCCTATTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-565s1c1
Sequence:CCGGCCTGGAATTGAGAAGTTCAAACTCGAGTTTGAACTTCTCAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-827s1c1
Sequence:CCGGGCCAATCATTAGCAAACAAATCTCGAGATTTGTTTGCTAATGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-1278s1c1
Sequence:CCGGGCCCTCACAGAGTGAAATGATCTCGAGATCATTTCACTCTGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-306s1c1
Sequence:CCGGCCCAGATCATTATCCCAACTTCTCGAGAAGTTGGGATAATGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001461
FMO5 MISSION shRNA shRNA Plasmid DNA
flavin containing monooxygenase 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-1619s1c1
Sequence:CCGGCAATGACAATAGGCAAGTTTACTCGAGTAAACTTGCCTATTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-565s1c1
Sequence:CCGGCCTGGAATTGAGAAGTTCAAACTCGAGTTTGAACTTCTCAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-827s1c1
Sequence:CCGGGCCAATCATTAGCAAACAAATCTCGAGATTTGTTTGCTAATGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-1278s1c1
Sequence:CCGGGCCCTCACAGAGTGAAATGATCTCGAGATCATTTCACTCTGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-306s1c1
Sequence:CCGGCCCAGATCATTATCCCAACTTCTCGAGAAGTTGGGATAATGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001461
FMO5 MISSION shRNA Lentiviral Transduction Particles
flavin containing monooxygenase 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-1619s1c1
Sequence:CCGGCAATGACAATAGGCAAGTTTACTCGAGTAAACTTGCCTATTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-565s1c1
Sequence:CCGGCCTGGAATTGAGAAGTTCAAACTCGAGTTTGAACTTCTCAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-827s1c1
Sequence:CCGGGCCAATCATTAGCAAACAAATCTCGAGATTTGTTTGCTAATGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-1278s1c1
Sequence:CCGGGCCCTCACAGAGTGAAATGATCTCGAGATCATTTCACTCTGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001461.1-306s1c1
Sequence:CCGGCCCAGATCATTATCCCAACTTCTCGAGAAGTTGGGATAATGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks