EMAIL THIS PAGE TO A FRIEND

FMO6P

flavin containing monooxygenase 6 pseudogene

12 Gene Product Result for
Synonyms: FMO6
Species: Human FMO6P(388714), chicken FMO6P(395267)
UniProtKB ID: O60774
Gene ID:
chicken(395267) flavin containing monooxygenase 6 pseudogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371326 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002601 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00376270 predicted 983
2 SASI_Hs02_00376271 predicted 1501
3 SASI_Hs02_00376272 predicted 1274
4 SASI_Hs02_00376273 predicted 1348
5 SASI_Hs02_00376274 predicted 1361
6 SASI_Hs02_00376275 predicted 1502
7 SASI_Hs02_00376276 predicted 1560
8 SASI_Hs02_00376277 predicted 1498
9 SASI_Hs02_00376278 predicted 1036
10 SASI_Hs02_00376279 predicted 1404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371326
FMO6P MISSION shRNA Bacterial Glycerol Stock
flavin containing monooxygenase 6 pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-154s1c1
Sequence:CCGGGCCAGCATTTACCAGTCTGTACTCGAGTACAGACTGGTAAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-1209s1c1
Sequence:CCGGCCTGCCAACCACGAATGAAATCTCGAGATTTCATTCGTGGTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-1272s1c1
Sequence:CCGGCCCATACCAGTTTCGACTGATCTCGAGATCAGTCGAAACTGGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-703s1c1
Sequence:CCGGCCTTGGGATATGATGTATGTTCTCGAGAACATACATCATATCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-223s1c1
Sequence:CCGGCCGGATGATTACCCAAACTATCTCGAGATAGTTTGGGTAATCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371326
FMO6P MISSION shRNA shRNA Plasmid DNA
flavin containing monooxygenase 6 pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-154s1c1
Sequence:CCGGGCCAGCATTTACCAGTCTGTACTCGAGTACAGACTGGTAAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-1209s1c1
Sequence:CCGGCCTGCCAACCACGAATGAAATCTCGAGATTTCATTCGTGGTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-1272s1c1
Sequence:CCGGCCCATACCAGTTTCGACTGATCTCGAGATCAGTCGAAACTGGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-703s1c1
Sequence:CCGGCCTTGGGATATGATGTATGTTCTCGAGAACATACATCATATCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-223s1c1
Sequence:CCGGCCGGATGATTACCCAAACTATCTCGAGATAGTTTGGGTAATCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371326
FMO6P MISSION shRNA Lentiviral Transduction Particles
flavin containing monooxygenase 6 pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-154s1c1
Sequence:CCGGGCCAGCATTTACCAGTCTGTACTCGAGTACAGACTGGTAAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-1209s1c1
Sequence:CCGGCCTGCCAACCACGAATGAAATCTCGAGATTTCATTCGTGGTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-1272s1c1
Sequence:CCGGCCCATACCAGTTTCGACTGATCTCGAGATCAGTCGAAACTGGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-703s1c1
Sequence:CCGGCCTTGGGATATGATGTATGTTCTCGAGAACATACATCATATCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371326.1-223s1c1
Sequence:CCGGCCGGATGATTACCCAAACTATCTCGAGATAGTTTGGGTAATCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks