EMAIL THIS PAGE TO A FRIEND

FMO9P

flavin containing monooxygenase 9 pseudogene

Species: Human FMO9P(116123)
Gene ID:
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408250 Anti-FMO9P antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138784 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002925 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00377319 predicted 981
2 SASI_Hs02_00377320 predicted 728
3 SASI_Hs02_00377321 predicted 1055
4 SASI_Hs02_00377322 predicted 843
5 SASI_Hs02_00377323 predicted 734
6 SASI_Hs02_00377324 predicted 676
7 SASI_Hs02_00377325 predicted 627
8 SASI_Hs02_00377326 predicted 670
9 SASI_Hs02_00377327 predicted 969
10 SASI_Hs02_00377328 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138784
FMO9P MISSION shRNA Bacterial Glycerol Stock
flavin containing monooxygenase 9 pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138784.1-1118s1c1
Sequence:CCGGGCTATGTCAATGTCCAGGGAACTCGAGTTCCCTGGACATTGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138784.1-664s1c1
Sequence:CCGGCCAGGCATTGAGAAATTTGAACTCGAGTTCAAATTTCTCAATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138784.1-817s1c1
Sequence:CCGGCCAGTAGGAACTGAGATTCAACTCGAGTTGAATCTCAGTTCCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138784.1-689s1c1
Sequence:CCGGGTTATTTCCATAGTCGGGAATCTCGAGATTCCCGACTATGGAAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138784.1-479s1c1
Sequence:CCGGGCCTCCTGAATTACATTCGTTCTCGAGAACGAATGTAATTCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138784
FMO9P MISSION shRNA shRNA Plasmid DNA
flavin containing monooxygenase 9 pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138784.1-1118s1c1
Sequence:CCGGGCTATGTCAATGTCCAGGGAACTCGAGTTCCCTGGACATTGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138784.1-664s1c1
Sequence:CCGGCCAGGCATTGAGAAATTTGAACTCGAGTTCAAATTTCTCAATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138784.1-817s1c1
Sequence:CCGGCCAGTAGGAACTGAGATTCAACTCGAGTTGAATCTCAGTTCCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138784.1-689s1c1
Sequence:CCGGGTTATTTCCATAGTCGGGAATCTCGAGATTCCCGACTATGGAAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138784.1-479s1c1
Sequence:CCGGGCCTCCTGAATTACATTCGTTCTCGAGAACGAATGTAATTCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138784
FMO9P MISSION shRNA Lentiviral Transduction Particles
flavin containing monooxygenase 9 pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138784.1-1118s1c1
Sequence:CCGGGCTATGTCAATGTCCAGGGAACTCGAGTTCCCTGGACATTGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138784.1-664s1c1
Sequence:CCGGCCAGGCATTGAGAAATTTGAACTCGAGTTCAAATTTCTCAATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138784.1-817s1c1
Sequence:CCGGCCAGTAGGAACTGAGATTCAACTCGAGTTGAATCTCAGTTCCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138784.1-689s1c1
Sequence:CCGGGTTATTTCCATAGTCGGGAATCTCGAGATTCCCGACTATGGAAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138784.1-479s1c1
Sequence:CCGGGCCTCCTGAATTACATTCGTTCTCGAGAACGAATGTAATTCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks