EMAIL THIS PAGE TO A FRIEND

FMOD

fibromodulin

81 Gene Product Result for
Synonyms: FM SLRR2E
UniProtKB ID: Q06828, Q15331, Q8IV47
Gene ID:
Human(2331) Summary: Fibromodulin belongs to the family of small interstitial proteoglycans. The encoded protein possesses a central region containing leucine-rich repeats with 4 keratan sulfate chains, flanked by terminal domains containing disulphide bonds. Owing to the interaction with type I and type II collagen fibrils and in vitro inhibition of fibrillogenesis, the encoded protein may play a role in the assembly of extracellular matrix. It may also regulate TGF-beta activities by sequestering TGF-beta into the extracellular matrix. Sequence variations in this gene may be associated with the pathogenesis of high myopia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Mouse(14264) fibromodulin
Rat(64507) fibromodulin
chicken(395814) fibromodulin
Horse(100009678) fibromodulin
cow(281168) fibromodulin
dog(488560) fibromodulin
sheep(101111037) fibromodulin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002023 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021355 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021355 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021355 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002023 Rosetta Predictions human pricing
NM_080698 Rosetta Predictions rat pricing
NM_021355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181442 predicted 1680
2 SASI_Hs02_00333042 predicted 1033
3 SASI_Hs01_00181443 predicted 742
4 SASI_Hs01_00181444 predicted 1302
5 SASI_Hs01_00181445 predicted 826
6 SASI_Hs01_00181446 predicted 1584
7 SASI_Hs01_00181447 predicted 1098
8 SASI_Hs01_00181448 predicted 865
9 SASI_Hs01_00181450 predicted 963
10 SASI_Hs01_00181451 predicted 1689
11 SASI_Hs01_00181449 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091410 predicted 968
2 SASI_Rn01_00091411 predicted 1017
3 SASI_Rn01_00091412 predicted 873
4 SASI_Rn01_00091413 predicted 467
5 SASI_Rn01_00091414 predicted 655
6 SASI_Rn01_00091415 predicted 896
7 SASI_Rn01_00091416 predicted 1108
8 SASI_Rn01_00091417 predicted 1412
9 SASI_Rn01_00091418 predicted 727
10 SASI_Rn02_00267286 predicted 1508
11 SASI_Rn01_00091419 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192838 predicted 682
2 SASI_Mm01_00192839 predicted 1485
3 SASI_Mm01_00192840 predicted 685
4 SASI_Mm01_00192841 predicted 901
5 SASI_Mm01_00192842 predicted 1470
6 SASI_Mm01_00192844 predicted 678
7 SASI_Mm01_00192845 predicted 753
8 SASI_Mm01_00192846 predicted 1042
9 SASI_Mm02_00325944 predicted 494
10 SASI_Mm01_00192847 predicted 813
11 SASI_Mm01_00192843 predicted 1352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002023
VALIDATED
FMOD MISSION shRNA Bacterial Glycerol Stock
fibromodulin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002023.2-845s1c1
Sequence:CCGGGTCCCACAACAGTCTAACCAACTCGAGTTGGTTAGACTGTTGTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002023.2-158s1c1
Sequence:CCGGGTATGAGACCTACGAGCCTTACTCGAGTAAGGCTCGTAGGTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_002023.2-75s1c1
Sequence:CCGGCAGTATGAAGATGACCCTCATCTCGAGATGAGGGTCATCTTCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_002023.2-980s1c1
Sequence:CCGGCCAAGGCAATAGGATCAATGACTCGAGTCATTGATCCTATTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002023.2-849s1c1
Sequence:CCGGCACAACAGTCTAACCAACAATCTCGAGATTGTTGGTTAGACTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002023.2-2163s1c1
Sequence:CCGGCCAAGCAGGAAGATTCTATATCTCGAGATATAGAATCTTCCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002023.2-335s1c1
Sequence:CCGGCCGCATGAAGTATGTGTACTTCTCGAGAAGTACACATACTTCATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002023.2-848s1c1
Sequence:CCGGCCACAACAGTCTAACCAACAACTCGAGTTGTTGGTTAGACTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002023.2-765s1c1
Sequence:CCGGCTGTACATGGAGCACAACAATCTCGAGATTGTTGTGCTCCATGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002023.2-1877s1c1
Sequence:CCGGCCTCAGGCTTAGATCAATGTACTCGAGTACATTGATCTAAGCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002023
VALIDATED
FMOD MISSION shRNA shRNA Plasmid DNA
fibromodulin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002023.2-845s1c1
Sequence:CCGGGTCCCACAACAGTCTAACCAACTCGAGTTGGTTAGACTGTTGTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002023.2-158s1c1
Sequence:CCGGGTATGAGACCTACGAGCCTTACTCGAGTAAGGCTCGTAGGTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_002023.2-75s1c1
Sequence:CCGGCAGTATGAAGATGACCCTCATCTCGAGATGAGGGTCATCTTCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_002023.2-980s1c1
Sequence:CCGGCCAAGGCAATAGGATCAATGACTCGAGTCATTGATCCTATTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002023.2-849s1c1
Sequence:CCGGCACAACAGTCTAACCAACAATCTCGAGATTGTTGGTTAGACTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002023.2-2163s1c1
Sequence:CCGGCCAAGCAGGAAGATTCTATATCTCGAGATATAGAATCTTCCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002023.2-335s1c1
Sequence:CCGGCCGCATGAAGTATGTGTACTTCTCGAGAAGTACACATACTTCATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002023.2-848s1c1
Sequence:CCGGCCACAACAGTCTAACCAACAACTCGAGTTGTTGGTTAGACTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002023.2-765s1c1
Sequence:CCGGCTGTACATGGAGCACAACAATCTCGAGATTGTTGTGCTCCATGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002023.2-1877s1c1
Sequence:CCGGCCTCAGGCTTAGATCAATGTACTCGAGTACATTGATCTAAGCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002023
VALIDATED
FMOD MISSION shRNA Lentiviral Transduction Particles
fibromodulin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002023.2-845s1c1
Sequence:CCGGGTCCCACAACAGTCTAACCAACTCGAGTTGGTTAGACTGTTGTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002023.2-158s1c1
Sequence:CCGGGTATGAGACCTACGAGCCTTACTCGAGTAAGGCTCGTAGGTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_002023.2-75s1c1
Sequence:CCGGCAGTATGAAGATGACCCTCATCTCGAGATGAGGGTCATCTTCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_002023.2-980s1c1
Sequence:CCGGCCAAGGCAATAGGATCAATGACTCGAGTCATTGATCCTATTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002023.2-849s1c1
Sequence:CCGGCACAACAGTCTAACCAACAATCTCGAGATTGTTGGTTAGACTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002023.2-2163s1c1
Sequence:CCGGCCAAGCAGGAAGATTCTATATCTCGAGATATAGAATCTTCCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002023.2-335s1c1
Sequence:CCGGCCGCATGAAGTATGTGTACTTCTCGAGAAGTACACATACTTCATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002023.2-848s1c1
Sequence:CCGGCCACAACAGTCTAACCAACAACTCGAGTTGTTGGTTAGACTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002023.2-765s1c1
Sequence:CCGGCTGTACATGGAGCACAACAATCTCGAGATTGTTGTGCTCCATGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002023.2-1877s1c1
Sequence:CCGGCCTCAGGCTTAGATCAATGTACTCGAGTACATTGATCTAAGCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021355
FMOD MISSION shRNA Bacterial Glycerol Stock
fibromodulin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021355.2-2706s1c1
Sequence:CCGGGCGGCCAACCTAACCAATAAACTCGAGTTTATTGGTTAGGTTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021355.2-392s1c1
Sequence:CCGGCCGCATGAAGTACGTCTACTTCTCGAGAAGTAGACGTACTTCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021355.2-338s1c1
Sequence:CCGGCACAGCCATGTACTGTGACAACTCGAGTTGTCACAGTACATGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021355.2-901s1c1
Sequence:CCGGTGTCTCACAACAGTCTCACTACTCGAGTAGTGAGACTGTTGTGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021355.2-827s1c1
Sequence:CCGGCCTAGAACACAACAATGTCTACTCGAGTAGACATTGTTGTGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021355
FMOD MISSION shRNA shRNA Plasmid DNA
fibromodulin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021355.2-2706s1c1
Sequence:CCGGGCGGCCAACCTAACCAATAAACTCGAGTTTATTGGTTAGGTTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021355.2-392s1c1
Sequence:CCGGCCGCATGAAGTACGTCTACTTCTCGAGAAGTAGACGTACTTCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021355.2-338s1c1
Sequence:CCGGCACAGCCATGTACTGTGACAACTCGAGTTGTCACAGTACATGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021355.2-901s1c1
Sequence:CCGGTGTCTCACAACAGTCTCACTACTCGAGTAGTGAGACTGTTGTGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021355.2-827s1c1
Sequence:CCGGCCTAGAACACAACAATGTCTACTCGAGTAGACATTGTTGTGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021355
FMOD MISSION shRNA Lentiviral Transduction Particles
fibromodulin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021355.2-2706s1c1
Sequence:CCGGGCGGCCAACCTAACCAATAAACTCGAGTTTATTGGTTAGGTTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021355.2-392s1c1
Sequence:CCGGCCGCATGAAGTACGTCTACTTCTCGAGAAGTAGACGTACTTCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021355.2-338s1c1
Sequence:CCGGCACAGCCATGTACTGTGACAACTCGAGTTGTCACAGTACATGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021355.2-901s1c1
Sequence:CCGGTGTCTCACAACAGTCTCACTACTCGAGTAGTGAGACTGTTGTGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021355.2-827s1c1
Sequence:CCGGCCTAGAACACAACAATGTCTACTCGAGTAGACATTGTTGTGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks