EMAIL THIS PAGE TO A FRIEND

FMR1

fragile X mental retardation 1

63 Gene Product Result for
Synonyms: FMRP FRAXA POF POF1
Gene ID:
Human(2332) Summary: The protein encoded by this gene binds RNA and is associated with polysomes. The encoded protein may be involved in mRNA trafficking from the nucleus to the cytoplasm. A trinucleotide repeat (CGG) in the 5' UTR is normally found at 6-53 copies, but an expansion to 55-230 repeats is the cause of fragile X syndrome. Expansion of the trinucleotide repeat may also cause one form of premature ovarian failure (POF1). Multiple alternatively spliced transcript variants that encode different protein isoforms and which are located in different cellular locations have been described for this gene. [provided by RefSeq, May 2010]
Mouse(14265) fragile X mental retardation syndrome 1
Rat(24948) fragile X mental retardation 1
Zebrafish(259191) fragile X mental retardation 1
cow(507482) fragile X mental retardation 1
domestic cat(101080266) fragile X mental retardation 1
dog(481070) fragile X mental retardation 1
chicken(422395) fragile X mental retardation 1
fruit fly(37528) CG6203 gene product from transcript CG6203-RC
sheep(101117478) fragile X mental retardation 1
naked mole-rat(101707722) fragile X mental retardation 1
domestic guinea pig(100734782) fragile X mental retardation 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105888 Anti-FMR1 (36-49) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
F4055 Anti-FMR1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunofluorescence, immunoprecipitation, western blot pricing
F3930 Anti-FMR1 (N-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse (predicted), rat (predicted)
western blot pricing
SAB2500407 Anti-FMR1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, human, rat
ELISA, western blot pricing
SAB2501256 Anti-FMR1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat
ELISA, immunohistochemistry, western blot pricing
SAB2702406 Anti-Fmr1 antibody produced in rabbit affinity isolated antibody zebrafish
western blot pricing
HPA050118 Anti-FMR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA056084 Anti-FMR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106512 Anti-FMR1 antibody produced in rabbit affinity isolated antibody guinea pig, human, rat, rabbit
ELISA, western blot pricing
SAB3501105 Anti-FMR1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
F4554 Monoclonal Anti-dFMR1 antibody produced in mouse clone 6A15, purified immunoglobulin, buffered aqueous solution Drosophila
immunocytochemistry, immunoprecipitation, western blot pricing
WH0002332M1 Monoclonal Anti-FMR1 antibody produced in mouse clone 2D4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403834 Monoclonal Anti-FMR1 antibody produced in mouse clone 3E11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100418 Monoclonal Anti-FMR1 antibody produced in mouse clone FMR1-B317, culture supernatant human
western blot pricing
SAB4200597 Monoclonal Anti-FMR1 antibody produced in mouse clone FMR2.5, hybridoma cell culture supernatant hamster, rat, human, mouse
flow cytometry, immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002024 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002024 Rosetta Predictions human pricing
NM_052804 Rosetta Predictions rat pricing
NM_008031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139633 predicted 887
2 SASI_Hs01_00139634 predicted 857
3 SASI_Hs01_00139635 predicted 384
4 SASI_Hs01_00139636 predicted 939
5 SASI_Hs01_00139637 predicted 1534
6 SASI_Hs01_00139638 predicted 383
7 SASI_Hs01_00139639 predicted 1004
8 SASI_Hs01_00139640 predicted 1019
9 SASI_Hs01_00139641 predicted 378
10 SASI_Hs01_00139642 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049224 predicted 857
2 SASI_Rn01_00049225 predicted 339
3 SASI_Rn02_00265595 predicted 371
4 SASI_Rn01_00049226 predicted 884
5 SASI_Rn01_00049227 predicted 1432
6 SASI_Rn01_00049228 predicted 1965
7 SASI_Rn01_00049229 predicted 1027
8 SASI_Rn01_00049230 predicted 472
9 SASI_Rn01_00049232 predicted 424
10 SASI_Rn01_00049233 predicted 892
11 SASI_Rn01_00049231 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044074 predicted 937
2 SASI_Mm01_00044075 predicted 956
3 SASI_Mm01_00044076 predicted 1574
4 SASI_Mm01_00044077 predicted 2108
5 SASI_Mm01_00044078 predicted 691
6 SASI_Mm01_00044079 predicted 1502
7 SASI_Mm01_00044080 predicted 1098
8 SASI_Mm01_00044081 predicted 1251
9 SASI_Mm01_00044082 predicted 535
10 SASI_Mm02_00312987 predicted 947
11 SASI_Mm01_00044083 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002024
VALIDATED
FMR1 MISSION shRNA Bacterial Glycerol Stock
fragile X mental retardation 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002024.1-1509s1c1
Sequence:CCGGGCGTTTGGAGAGATTACAAATCTCGAGATTTGTAATCTCTCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002024.1-795s1c1
Sequence:CCGGGCGCACTAAGTTGTCTCTGATCTCGAGATCAGAGACAACTTAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_002024.1-869s1c1
Sequence:CCGGCGAGATTTCATGAACAGTTTACTCGAGTAAACTGTTCATGAAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002024.1-1892s1c1
Sequence:CCGGGAACAGATAATCGTCCACGTACTCGAGTACGTGGACGATTATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002024.4-765s21c1
Sequence:CCGGGCGCACTAAGTTGTCTCTGATCTCGAGATCAGAGACAACTTAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002024.4-588s21c1
Sequence:CCGGGCCAGAAGACTTACGGCAAATCTCGAGATTTGCCGTAAGTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002024.4-839s21c1
Sequence:CCGGCGAGATTTCATGAACAGTTTACTCGAGTAAACTGTTCATGAAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002024.4-2113s21c1
Sequence:CCGGTCCTATACCATTTCCGTAATTCTCGAGAATTACGGAAATGGTATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002024.4-1479s21c1
Sequence:CCGGGCGTTTGGAGAGATTACAAATCTCGAGATTTGTAATCTCTCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002024
VALIDATED
FMR1 MISSION shRNA shRNA Plasmid DNA
fragile X mental retardation 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002024.1-1509s1c1
Sequence:CCGGGCGTTTGGAGAGATTACAAATCTCGAGATTTGTAATCTCTCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002024.1-795s1c1
Sequence:CCGGGCGCACTAAGTTGTCTCTGATCTCGAGATCAGAGACAACTTAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_002024.1-869s1c1
Sequence:CCGGCGAGATTTCATGAACAGTTTACTCGAGTAAACTGTTCATGAAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002024.1-1892s1c1
Sequence:CCGGGAACAGATAATCGTCCACGTACTCGAGTACGTGGACGATTATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002024.4-765s21c1
Sequence:CCGGGCGCACTAAGTTGTCTCTGATCTCGAGATCAGAGACAACTTAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002024.4-588s21c1
Sequence:CCGGGCCAGAAGACTTACGGCAAATCTCGAGATTTGCCGTAAGTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002024.4-839s21c1
Sequence:CCGGCGAGATTTCATGAACAGTTTACTCGAGTAAACTGTTCATGAAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002024.4-2113s21c1
Sequence:CCGGTCCTATACCATTTCCGTAATTCTCGAGAATTACGGAAATGGTATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002024.4-1479s21c1
Sequence:CCGGGCGTTTGGAGAGATTACAAATCTCGAGATTTGTAATCTCTCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002024
VALIDATED
FMR1 MISSION shRNA Lentiviral Transduction Particles
fragile X mental retardation 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002024.1-1509s1c1
Sequence:CCGGGCGTTTGGAGAGATTACAAATCTCGAGATTTGTAATCTCTCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002024.1-795s1c1
Sequence:CCGGGCGCACTAAGTTGTCTCTGATCTCGAGATCAGAGACAACTTAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_002024.1-869s1c1
Sequence:CCGGCGAGATTTCATGAACAGTTTACTCGAGTAAACTGTTCATGAAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002024.1-1892s1c1
Sequence:CCGGGAACAGATAATCGTCCACGTACTCGAGTACGTGGACGATTATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002024.4-765s21c1
Sequence:CCGGGCGCACTAAGTTGTCTCTGATCTCGAGATCAGAGACAACTTAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002024.4-588s21c1
Sequence:CCGGGCCAGAAGACTTACGGCAAATCTCGAGATTTGCCGTAAGTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002024.4-839s21c1
Sequence:CCGGCGAGATTTCATGAACAGTTTACTCGAGTAAACTGTTCATGAAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002024.4-2113s21c1
Sequence:CCGGTCCTATACCATTTCCGTAATTCTCGAGAATTACGGAAATGGTATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002024.4-1479s21c1
Sequence:CCGGGCGTTTGGAGAGATTACAAATCTCGAGATTTGTAATCTCTCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008031
VALIDATED
FMR1 MISSION shRNA Bacterial Glycerol Stock
fragile X mental retardation 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-2800s1c1
Sequence:CCGGCCTTACATAAACATCAGCTTACTCGAGTAAGCTGATGTTTATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-839s1c1
Sequence:CCGGCGCACCAAGTTGTCTCTTATACTCGAGTATAAGAGACAACTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-1127s1c1
Sequence:CCGGCCACGAAACTTAGTAGGCAAACTCGAGTTTGCCTACTAAGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-1607s1c1
Sequence:CCGGCCACCACCAAATCGTACAGATCTCGAGATCTGTACGATTTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-514s1c1
Sequence:CCGGGAGGATGATAAAGGGTGAGTTCTCGAGAACTCACCCTTTATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-2137s21c1
Sequence:CCGGCCTCTACCATTTCCGTAATTCCTCGAGGAATTACGGAAATGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-2439s21c1
Sequence:CCGGGTTTCAGTCTTTCGGAGTAAACTCGAGTTTACTCCGAAAGACTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-1607s21c1
Sequence:CCGGCCACCACCAAATCGTACAGATCTCGAGATCTGTACGATTTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-839s21c1
Sequence:CCGGCGCACCAAGTTGTCTCTTATACTCGAGTATAAGAGACAACTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-514s21c1
Sequence:CCGGGAGGATGATAAAGGGTGAGTTCTCGAGAACTCACCCTTTATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008031
VALIDATED
FMR1 MISSION shRNA shRNA Plasmid DNA
fragile X mental retardation 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-2800s1c1
Sequence:CCGGCCTTACATAAACATCAGCTTACTCGAGTAAGCTGATGTTTATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-839s1c1
Sequence:CCGGCGCACCAAGTTGTCTCTTATACTCGAGTATAAGAGACAACTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-1127s1c1
Sequence:CCGGCCACGAAACTTAGTAGGCAAACTCGAGTTTGCCTACTAAGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-1607s1c1
Sequence:CCGGCCACCACCAAATCGTACAGATCTCGAGATCTGTACGATTTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-514s1c1
Sequence:CCGGGAGGATGATAAAGGGTGAGTTCTCGAGAACTCACCCTTTATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-2137s21c1
Sequence:CCGGCCTCTACCATTTCCGTAATTCCTCGAGGAATTACGGAAATGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-2439s21c1
Sequence:CCGGGTTTCAGTCTTTCGGAGTAAACTCGAGTTTACTCCGAAAGACTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-1607s21c1
Sequence:CCGGCCACCACCAAATCGTACAGATCTCGAGATCTGTACGATTTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-839s21c1
Sequence:CCGGCGCACCAAGTTGTCTCTTATACTCGAGTATAAGAGACAACTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-514s21c1
Sequence:CCGGGAGGATGATAAAGGGTGAGTTCTCGAGAACTCACCCTTTATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008031
VALIDATED
FMR1 MISSION shRNA Lentiviral Transduction Particles
fragile X mental retardation 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-2800s1c1
Sequence:CCGGCCTTACATAAACATCAGCTTACTCGAGTAAGCTGATGTTTATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-839s1c1
Sequence:CCGGCGCACCAAGTTGTCTCTTATACTCGAGTATAAGAGACAACTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-1127s1c1
Sequence:CCGGCCACGAAACTTAGTAGGCAAACTCGAGTTTGCCTACTAAGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-1607s1c1
Sequence:CCGGCCACCACCAAATCGTACAGATCTCGAGATCTGTACGATTTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008031.2-514s1c1
Sequence:CCGGGAGGATGATAAAGGGTGAGTTCTCGAGAACTCACCCTTTATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-2137s21c1
Sequence:CCGGCCTCTACCATTTCCGTAATTCCTCGAGGAATTACGGAAATGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-2439s21c1
Sequence:CCGGGTTTCAGTCTTTCGGAGTAAACTCGAGTTTACTCCGAAAGACTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-1607s21c1
Sequence:CCGGCCACCACCAAATCGTACAGATCTCGAGATCTGTACGATTTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-839s21c1
Sequence:CCGGCGCACCAAGTTGTCTCTTATACTCGAGTATAAGAGACAACTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008031.2-514s21c1
Sequence:CCGGGAGGATGATAAAGGGTGAGTTCTCGAGAACTCACCCTTTATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks