EMAIL THIS PAGE TO A FRIEND

FMR1NB

fragile X mental retardation 1 neighbor

Synonyms: CT37 NY-SAR-35 NYSAR35
UniProtKB ID: Q8N0W7, D3DWT3
Gene ID:
Mouse(207854) fragile X mental retardation 1 neighbor
Rat(293918) fragile X mental retardation 1 neighbor
chicken(101748316) fragile X mental retardation 1 neighbor
cow(613334) fragile X mental retardation 1 neighbor
dog(481071) fragile X mental retardation 1 neighbor
sheep(101117222) fragile X mental retardation 1 neighbor
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152578 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152578 Rosetta Predictions human pricing
XM_001055042 Rosetta Predictions rat pricing
XM_215239 Rosetta Predictions rat pricing
NM_174993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214918 predicted 264
2 SASI_Hs01_00214919 predicted 612
3 SASI_Hs01_00214921 predicted 282
4 SASI_Hs01_00214922 predicted 498
5 SASI_Hs01_00214923 predicted 647
6 SASI_Hs01_00214924 predicted 651
7 SASI_Hs01_00214925 predicted 714
8 SASI_Hs02_00366396 predicted 282
9 SASI_Hs02_00366397 predicted 654
10 SASI_Hs02_00366398 predicted 315
11 SASI_Hs01_00214917 predicted 778
12 SASI_Hs01_00214920 predicted 678
13 SASI_Hs01_00214926 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278192 predicted 432
2 SASI_Rn02_00278193 predicted 452
3 SASI_Rn02_00278194 predicted 416
4 SASI_Rn02_00278195 predicted 444
5 SASI_Rn02_00278196 predicted 564
6 SASI_Rn02_00278197 predicted 235
7 SASI_Rn02_00278198 predicted 618
8 SASI_Rn02_00278199 predicted 545
9 SASI_Rn02_00278200 predicted 307
10 SASI_Rn02_00278201 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375885 predicted 433
2 SASI_Rn02_00375886 predicted 452
3 SASI_Rn02_00375887 predicted 407
4 SASI_Rn02_00375888 predicted 449
5 SASI_Rn02_00375889 predicted 571
6 SASI_Rn02_00375890 predicted 232
7 SASI_Rn02_00375891 predicted 615
8 SASI_Rn02_00375892 predicted 541
9 SASI_Rn02_00375893 predicted 305
10 SASI_Rn02_00375894 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102575 predicted 472
2 SASI_Mm01_00102576 predicted 473
3 SASI_Mm01_00102577 predicted 276
4 SASI_Mm01_00102578 predicted 200
5 SASI_Mm01_00102579 predicted 260
6 SASI_Mm01_00102580 predicted 286
7 SASI_Mm01_00102581 predicted 414
8 SASI_Mm01_00102582 predicted 402
9 SASI_Mm01_00102583 predicted 293
10 SASI_Mm01_00102584 predicted 297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152578
FMR1NB MISSION shRNA Bacterial Glycerol Stock
fragile X mental retardation 1 neighbor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152578.2-521s21c1
Sequence:CCGGAGATCTTAGTGAGAGTGAATGCTCGAGCATTCACTCTCACTAAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-675s1c1
Sequence:CCGGCCCATTTATTGCCGCTCTCTTCTCGAGAAGAGAGCGGCAATAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-737s1c1
Sequence:CCGGCAACAGAGTTGTAACGGGTTTCTCGAGAAACCCGTTACAACTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152578.1-154s1c1
Sequence:CCGGCAACTTATGAGTTGGCGGCAACTCGAGTTGCCGCCAACTCATAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-139s1c1
Sequence:CCGGCTCACTTAGAGCTGGCAACTTCTCGAGAAGTTGCCAGCTCTAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152578.1-504s1c1
Sequence:CCGGCCTTGTAATGAGCTGCAAGATCTCGAGATCTTGCAGCTCATTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-614s1c1
Sequence:CCGGGCCTAAACAGATGATGCAAATCTCGAGATTTGCATCATCTGTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152578.1-868s1c1
Sequence:CCGGCTCAAGACAACAGAAACCATTCTCGAGAATGGTTTCTGTTGTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-600s1c1
Sequence:CCGGCCATTTAGAGATGTGCCTAAACTCGAGTTTAGGCACATCTCTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152578
FMR1NB MISSION shRNA shRNA Plasmid DNA
fragile X mental retardation 1 neighbor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152578.2-521s21c1
Sequence:CCGGAGATCTTAGTGAGAGTGAATGCTCGAGCATTCACTCTCACTAAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-675s1c1
Sequence:CCGGCCCATTTATTGCCGCTCTCTTCTCGAGAAGAGAGCGGCAATAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-737s1c1
Sequence:CCGGCAACAGAGTTGTAACGGGTTTCTCGAGAAACCCGTTACAACTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152578.1-154s1c1
Sequence:CCGGCAACTTATGAGTTGGCGGCAACTCGAGTTGCCGCCAACTCATAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-139s1c1
Sequence:CCGGCTCACTTAGAGCTGGCAACTTCTCGAGAAGTTGCCAGCTCTAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152578.1-504s1c1
Sequence:CCGGCCTTGTAATGAGCTGCAAGATCTCGAGATCTTGCAGCTCATTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-614s1c1
Sequence:CCGGGCCTAAACAGATGATGCAAATCTCGAGATTTGCATCATCTGTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152578.1-868s1c1
Sequence:CCGGCTCAAGACAACAGAAACCATTCTCGAGAATGGTTTCTGTTGTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-600s1c1
Sequence:CCGGCCATTTAGAGATGTGCCTAAACTCGAGTTTAGGCACATCTCTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152578
FMR1NB MISSION shRNA Lentiviral Transduction Particles
fragile X mental retardation 1 neighbor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152578.2-521s21c1
Sequence:CCGGAGATCTTAGTGAGAGTGAATGCTCGAGCATTCACTCTCACTAAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-675s1c1
Sequence:CCGGCCCATTTATTGCCGCTCTCTTCTCGAGAAGAGAGCGGCAATAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-737s1c1
Sequence:CCGGCAACAGAGTTGTAACGGGTTTCTCGAGAAACCCGTTACAACTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152578.1-154s1c1
Sequence:CCGGCAACTTATGAGTTGGCGGCAACTCGAGTTGCCGCCAACTCATAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-139s1c1
Sequence:CCGGCTCACTTAGAGCTGGCAACTTCTCGAGAAGTTGCCAGCTCTAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152578.1-504s1c1
Sequence:CCGGCCTTGTAATGAGCTGCAAGATCTCGAGATCTTGCAGCTCATTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-614s1c1
Sequence:CCGGGCCTAAACAGATGATGCAAATCTCGAGATTTGCATCATCTGTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152578.1-868s1c1
Sequence:CCGGCTCAAGACAACAGAAACCATTCTCGAGAATGGTTTCTGTTGTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152578.1-600s1c1
Sequence:CCGGCCATTTAGAGATGTGCCTAAACTCGAGTTTAGGCACATCTCTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174993
FMR1NB MISSION shRNA Bacterial Glycerol Stock
fragile X mental retardation 1 neighbor
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000196035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174993.1-284s1c1
Sequence:CCGGGTCCTGTGAACACTGCGAAATCTCGAGATTTCGCAGTGTTCACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174993.1-105s1c1
Sequence:CCGGCGATACTCTTGCCCTCAGTATCTCGAGATACTGAGGGCAAGAGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174993.1-455s1c1
Sequence:CCGGCCAAGTGCTGTTCTTCAACATCTCGAGATGTTGAAGAACAGCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174993.1-339s1c1
Sequence:CCGGCCCTTTGGGAAATATGTTGGACTCGAGTCCAACATATTTCCCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174993
FMR1NB MISSION shRNA shRNA Plasmid DNA
fragile X mental retardation 1 neighbor
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000196035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174993.1-284s1c1
Sequence:CCGGGTCCTGTGAACACTGCGAAATCTCGAGATTTCGCAGTGTTCACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174993.1-105s1c1
Sequence:CCGGCGATACTCTTGCCCTCAGTATCTCGAGATACTGAGGGCAAGAGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174993.1-455s1c1
Sequence:CCGGCCAAGTGCTGTTCTTCAACATCTCGAGATGTTGAAGAACAGCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174993.1-339s1c1
Sequence:CCGGCCCTTTGGGAAATATGTTGGACTCGAGTCCAACATATTTCCCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174993
FMR1NB MISSION shRNA Lentiviral Transduction Particles
fragile X mental retardation 1 neighbor
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000196035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174993.1-284s1c1
Sequence:CCGGGTCCTGTGAACACTGCGAAATCTCGAGATTTCGCAGTGTTCACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174993.1-105s1c1
Sequence:CCGGCGATACTCTTGCCCTCAGTATCTCGAGATACTGAGGGCAAGAGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174993.1-455s1c1
Sequence:CCGGCCAAGTGCTGTTCTTCAACATCTCGAGATGTTGAAGAACAGCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174993.1-339s1c1
Sequence:CCGGCCCTTTGGGAAATATGTTGGACTCGAGTCCAACATATTTCCCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks