EMAIL THIS PAGE TO A FRIEND

FN1

fibronectin 1

237 Gene Product Result for
Synonyms: CIG ED-B FINC FN FNZ GFND GFND2 LETS MSF
Gene ID:
Human(2335) Summary: This gene encodes fibronectin, a glycoprotein present in a soluble dimeric form in plasma, and in a dimeric or multimeric form at the cell surface and in extracellular matrix. Fibronectin is involved in cell adhesion and migration processes including embryogenesis, wound healing, blood coagulation, host defense, and metastasis. The gene has three regions subject to alternative splicing, with the potential to produce 20 different transcript variants. However, the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(14268) fibronectin 1
Rat(25661) fibronectin 1
sheep(100216462) fibronectin 1
Zebrafish(100005469) fibronectin 1
chicken(396133) fibronectin 1
dog(403845) fibronectin 1
domestic cat(101081746) fibronectin 1
cow(280794) fibronectin 1
Horse(100034189) fibronectin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500974 Anti-Fibronectin 1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
GW20021F Anti-Fibronectin antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, western blot pricing
F3648 Anti-Fibronectin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, microarray, western blot pricing
SAB4200760 Anti-Fibronectin antibody, Mouse monoclonal clone FN-15, purified from hybridoma cell culture New mouse, human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB1405825 Anti-FN1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, proximity ligation assay, western blot pricing
AV41490 Anti-FN1 antibody produced in rabbit affinity isolated antibody human, canine, rabbit, guinea pig, horse, sheep, rabbit, bovine, rat, mouse
immunohistochemistry, western blot pricing
HPA027066 Anti-FN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2104810 Anti-FN1, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, human, horse, rabbit
western blot pricing
F7387 Monoclonal Anti-Fibronectin antibody produced in mouse clone FN-15, ascites fluid human, mouse, chicken
ELISA, immunofluorescence, microarray, western blot pricing
F0916 Monoclonal Anti-Fibronectin antibody produced in mouse clone IST-4, ascites fluid human
ELISA, immunocytochemistry, immunohistochemistry, radioimmunoassay, western blot pricing
F0791 Monoclonal Anti-Fibronectin antibody produced in mouse clone IST-3, ascites fluid canine, rabbit, human, sheep, bovine, goat, chicken
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, microarray, radioimmunoassay, western blot pricing
F6140 Monoclonal Anti-Fibronectin, Cellular antibody produced in mouse clone FN-3E2, ascites fluid human, mouse, chicken
immunofluorescence, immunohistochemistry, immunoprecipitation, radioimmunoassay, western blot pricing
AMAB91223 Monoclonal Anti-FN1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3730, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A5686 Arg-Gly-Glu-Ser acetate salt ≥95% (HPLC) human, mouse, rat pricing
G5646 Gly-Arg-Gly-Asp-Thr-Pro ≥97% (HPLC) human, mouse, rat pricing

Proteins

Product # Description Species Add to Cart
 
A8052 Arg-Gly-Asp ≥97% (TLC) human pricing
A6677 Arg-Gly-Asp-Ser-Pro-Ala-Ser-Ser-Lys-Pro ≥97% (HPLC) human pricing
F3542 Fibronectin Fragment III1-C human recombinant, expressed in E. coli, lyophilized powder, ≥90% (SDS-PAGE) human pricing
F2518 Fibronectin from human foreskin fibroblasts lyophilized powder, BioReagent, suitable for cell culture human pricing
F2006 Fibronectin from human plasma lyophilized powder, BioReagent, suitable for cell culture human pricing
F0895 Fibronectin from human plasma liquid, 0.1% (Solution), BioReagent, suitable for cell culture human pricing
F0287 Fibronectin Proteolytic Fragment from human plasma lyophilized powder, 70 kDa human pricing
F9911 Fibronectin Proteolytic Fragment from human plasma lyophilized powder, 30 kDa human pricing
F0556 Fibronectin solution from human fibroblasts cell culture derived, ~0.5 mg/mL, sterile-filtered, BioReagent, suitable for cell culture human pricing
F5007 Fibronectin Type III Connecting Segment Fragment 1-25 ≥90% (HPLC) human pricing
F6398 Fibronectin Type III Connecting Segment Fragment 90-109 ≥97% (HPLC) human pricing
APREST72592 PrEST Antigen FN1 Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22552 SILuPrEST FINC SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22553 SILuPrEST FINC SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
S5171 Superfibronectin from human plasma solution, sterile-filtered, BioReagent, suitable for cell culture human pricing
G1895 Gly-Pro-Arg-Pro ≥97% (HPLC) human, mouse, rat pricing
G5779 Gly-Pro-Arg-Pro amide ≥97% (HPLC) human, mouse, rat pricing
F0635 Fibronectin from rat plasma powder, BioReagent, suitable for cell culture rat pricing
F0162 Fibronectin Proteolytic Fragment from human plasma lyophilized powder, 45 kDa pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0501 AQUA Peptide STTPDITGY[R] human, mouse, rat pricing
AQ0932 AQUA Peptide SYTITGLQPGTDY[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002026 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_129845 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129845 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129845 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_010233 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010233 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010233 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB1945 Anti-Fibronectin Antibody Detect Fibronectin using this Anti-Fibronectin Antibody validated for use in ELISA & WB. pricing
AB1954 Anti-Fibronectin Antibody Anti-Fibronectin Antibody detects level of Fibronectin & has been published & validated for use in ELISA & WB. pricing
AB2033 Anti-Fibronectin Antibody Detect Fibronectin using this Anti-Fibronectin Antibody validated for use in ELISA, IC, IH, RIA. pricing
AB2040 Anti-Fibronectin Antibody Anti-Fibronectin Antibody is an antibody against Fibronectin for use in ELISA, RIA, IH. pricing
AB2047 Anti-Fibronectin Antibody Anti-Fibronectin Antibody detects level of Fibronectin & has been published & validated for use in ELISA, IF, RIA, WB, IH(P). pricing
MAB1937 Anti-Fibronectin Antibody, cell binding domain, clone 568 Anti-Fibronectin Antibody, cell binding domain, clone 568 is an antibody against Fibronectin for use in IF, IP, RIA, WB, IH. pricing
MAB1926 Anti-Fibronectin Antibody, cell binding domain, clone P1H11 This Anti-Fibronectin Antibody, cell binding domain, clone P1H11 is validated for use in ELISA, IP, WB, IC, IH for the detection of Fibronectin. pricing
MAB1934 Anti-Fibronectin Antibody, cell binding peptide, clone 784A2A6 Anti-Fibronectin Antibody, cell binding peptide, clone 784A2A6 detects level of Fibronectin & has been published & validated for use in ELISA & WB. pricing
MAB1940 Anti-Fibronectin Antibody, cellular, clone DH1 Detect Fibronectin using this Anti-Fibronectin Antibody, cellular, clone DH1 validated for use in WB, IH. pricing
MAB1935 Anti-Fibronectin Antibody, CT, clone 868A11 This Anti-Fibronectin Antibody, C-terminus, clone 868A11 is validated for use in ELISA, WB for the detection of Fibronectin. pricing
MAB1892 Anti-Fibronectin Antibody, gelatin binding domain, clone IST-10 Anti-Fibronectin Antibody, gelatin binding domain, clone IST-10 is an antibody against Fibronectin for use in WB, IH. pricing
MAB1932 Anti-Fibronectin Antibody, mid-molecule, clone 875A51 Detect Fibronectin using this Anti-Fibronectin Antibody, mid-molecule, clone 875A51 validated for use in ELISA & WB. pricing
MAB1936 Anti-Fibronectin Antibody, NT, clone 616 Anti-Fibronectin Antibody, N-terminus, clone 616 detects level of Fibronectin & has been published & validated for use in IH, IP, RIA & WB. pricing
MAB88916-C Anti-Fibronectin (Cell Attachment Fragment) Antibody, clone 3E3, Ascites & Azide Free This Anti-Fibronectin (Cell Attachment Fragment) Antibody, clone 3E3, Ascites & Azide Free is validated for use in western blotting, IHC, ELISA, ICC & inhibition for the detection of Fibronectin. pricing
MAB88916 Anti-Fibronectin Frag Antibody, cell attachment fragment, clone 3E3 Anti-Fibronectin Frag Antibody, cell attachment fragment, clone 3E3 is an antibody against Fibronectin Frag for use in ELISA, WB, IC, IH. pricing
F1904 Fibronectin 120 kDa α Chymotryptic Fragment (Cell Attachment region), Human purified pricing
F1903 Fibronectin 40 kDa α Chymotryptic Fragment (Heparin-binding region), Human purified pricing
FC010 Human Plasma Fibronectin Purified Protein This Human plasma fibronectin is a purified protein, used as an attachment factor suitable for cell propagation in vitro. pricing
ECM101 Millicoat™ Human Fibronectin Coated Strips (96-Wells) Millicoat Cell Adhesion Strips are provided as 12 x 8-well removable strips in a 96-well plate frame for convenience & flexibility in designing assays. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002026 Rosetta Predictions human pricing
NM_054034 Rosetta Predictions human pricing
NM_212474 Rosetta Predictions human pricing
NM_212475 Rosetta Predictions human pricing
NM_212476 Rosetta Predictions human pricing
NM_212478 Rosetta Predictions human pricing
NM_212482 Rosetta Predictions human pricing
NM_019143 Rosetta Predictions rat pricing
NM_010233 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203291 predicted 1543
2 SASI_Hs01_00203292 predicted 593
3 SASI_Hs02_00333045 predicted 538
4 SASI_Hs01_00203294 predicted 1918
5 SASI_Hs01_00203295 predicted 1716
6 SASI_Hs02_00333046 predicted 544
7 SASI_Hs01_00203297 predicted 978
8 SASI_Hs01_00203298 predicted 1018
9 SASI_Hs01_00203299 predicted 1770
10 SASI_Hs01_00203300 predicted 605
11 SASI_Hs01_00203293 predicted 1449
12 SASI_Hs01_00203296 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090097 predicted 1549
2 SASI_Hs01_00090098 predicted 593
3 SASI_Hs02_00361977 predicted 536
4 SASI_Hs01_00090100 predicted 1919
5 SASI_Hs01_00090101 predicted 1715
6 SASI_Hs02_00361978 predicted 545
7 SASI_Hs01_00090103 predicted 969
8 SASI_Hs01_00090104 predicted 1019
9 SASI_Hs01_00090105 predicted 1775
10 SASI_Hs01_00090106 predicted 601
11 SASI_Hs01_00090099 predicted 1450
12 SASI_Hs01_00090102 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207241 predicted 1546
2 SASI_Hs01_00207242 predicted 588
3 SASI_Hs02_00374198 predicted 542
4 SASI_Hs01_00207244 predicted 1918
5 SASI_Hs01_00207245 predicted 1715
6 SASI_Hs02_00374199 predicted 543
7 SASI_Hs01_00207247 predicted 971
8 SASI_Hs01_00207248 predicted 1014
9 SASI_Hs01_00207249 predicted 1778
10 SASI_Hs01_00207250 predicted 599
11 SASI_Hs01_00207243 predicted 1450
12 SASI_Hs01_00207246 predicted 1381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040537 predicted 1544
2 SASI_Hs01_00040538 predicted 587
3 SASI_Hs02_00374200 predicted 535
4 SASI_Hs01_00040540 predicted 1925
5 SASI_Hs01_00040541 predicted 1716
6 SASI_Hs02_00374201 predicted 545
7 SASI_Hs01_00040543 predicted 977
8 SASI_Hs01_00040544 predicted 1018
9 SASI_Hs01_00040545 predicted 1776
10 SASI_Hs01_00040546 predicted 605
11 SASI_Hs01_00040539 predicted 1456
12 SASI_Hs01_00040542 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171969 predicted 1550
2 SASI_Hs01_00171970 predicted 593
3 SASI_Hs02_00374202 predicted 534
4 SASI_Hs01_00171972 predicted 1921
5 SASI_Hs01_00171973 predicted 1713
6 SASI_Hs02_00374203 predicted 546
7 SASI_Hs01_00171975 predicted 973
8 SASI_Hs01_00171976 predicted 1023
9 SASI_Hs01_00171977 predicted 1772
10 SASI_Hs01_00171978 predicted 601
11 SASI_Hs01_00171971 predicted 1450
12 SASI_Hs01_00171974 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199844 predicted 1549
2 SASI_Hs01_00199845 predicted 595
3 SASI_Hs02_00374204 predicted 535
4 SASI_Hs01_00199847 predicted 1918
5 SASI_Hs01_00199848 predicted 1708
6 SASI_Hs02_00374205 predicted 542
7 SASI_Hs01_00199850 predicted 978
8 SASI_Hs01_00199851 predicted 1018
9 SASI_Hs01_00199852 predicted 1778
10 SASI_Hs01_00199853 predicted 600
11 SASI_Hs01_00199846 predicted 1459
12 SASI_Hs01_00199849 predicted 1372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212431 predicted 1548
2 SASI_Hs01_00212432 predicted 593
3 SASI_Hs02_00374209 predicted 541
4 SASI_Hs01_00212434 predicted 1925
5 SASI_Hs01_00212435 predicted 1709
6 SASI_Hs02_00374210 predicted 547
7 SASI_Hs01_00212437 predicted 971
8 SASI_Hs01_00212438 predicted 1021
9 SASI_Hs01_00212439 predicted 1774
10 SASI_Hs01_00212440 predicted 603
11 SASI_Hs01_00212433 predicted 1449
12 SASI_Hs01_00212436 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081405 predicted 4078
2 SASI_Rn01_00081406 predicted 7357
3 SASI_Rn01_00081407 predicted 5949
4 SASI_Rn01_00081409 predicted 3695
5 SASI_Rn02_00261909 predicted 2196
6 SASI_Rn02_00261910 predicted 7522
7 SASI_Rn01_00081411 predicted 7567
8 SASI_Rn01_00081412 predicted 2729
9 SASI_Rn02_00261911 predicted 1673
10 SASI_Rn01_00081413 predicted 1964
11 SASI_Rn01_00081408 predicted 7565
12 SASI_Rn01_00081410 predicted 4314
13 SASI_Rn01_00081414 predicted 5966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318091 predicted 1230
2 SASI_Mm01_00055333 predicted 6954
3 SASI_Mm02_00318092 predicted 4387
4 SASI_Mm01_00055335 predicted 7505
5 SASI_Mm01_00055336 predicted 4063
6 SASI_Mm01_00055337 predicted 7601
7 SASI_Mm02_00318093 predicted 6101
8 SASI_Mm01_00055338 predicted 2174
9 SASI_Mm01_00055339 predicted 624
10 SASI_Mm01_00055342 predicted 723
11 SASI_Mm01_00055334 predicted 4191
12 SASI_Mm01_00055340 predicted 507
13 SASI_Mm01_00055341 predicted 2720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002026
VALIDATED
FN1 MISSION shRNA Bacterial Glycerol Stock
fibronectin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002026.1-417s1c1
Sequence:CCGGCGGTTGTTATGACAATGGAAACTCGAGTTTCCATTGTCATAACAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002026.1-6799s1c1
Sequence:CCGGCCCTACACAGTTTCCCATTATCTCGAGATAATGGGAAACTGTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002026.1-3591s1c1
Sequence:CCGGGCCTGCTCCAAGAATTGGTTTCTCGAGAAACCAATTCTTGGAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002026.1-2250s1c1
Sequence:CCGGCCACTTAAACTCCTACACCATCTCGAGATGGTGTAGGAGTTTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-5594s21c1
Sequence:CCGGCGTGGTTGTATCAGGACTTATCTCGAGATAAGTCCTGATACAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-3590s21c1
Sequence:CCGGGCCTGCTCCAAGAATTGGTTTCTCGAGAAACCAATTCTTGGAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-6154s21c1
Sequence:CCGGTGGAACCGGGAACCGAATATACTCGAGTATATTCGGTTCCCGGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-7604s21c1
Sequence:CCGGAGATTTGGTTTGGGATCAATACTCGAGTATTGATCCCAAACCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-1422s21c1
Sequence:CCGGTGCAGCACAACTTCGAATTATCTCGAGATAATTCGAAGTTGTGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002026
VALIDATED
FN1 MISSION shRNA shRNA Plasmid DNA
fibronectin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002026.1-417s1c1
Sequence:CCGGCGGTTGTTATGACAATGGAAACTCGAGTTTCCATTGTCATAACAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002026.1-6799s1c1
Sequence:CCGGCCCTACACAGTTTCCCATTATCTCGAGATAATGGGAAACTGTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002026.1-3591s1c1
Sequence:CCGGGCCTGCTCCAAGAATTGGTTTCTCGAGAAACCAATTCTTGGAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002026.1-2250s1c1
Sequence:CCGGCCACTTAAACTCCTACACCATCTCGAGATGGTGTAGGAGTTTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-5594s21c1
Sequence:CCGGCGTGGTTGTATCAGGACTTATCTCGAGATAAGTCCTGATACAACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-3590s21c1
Sequence:CCGGGCCTGCTCCAAGAATTGGTTTCTCGAGAAACCAATTCTTGGAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-6154s21c1
Sequence:CCGGTGGAACCGGGAACCGAATATACTCGAGTATATTCGGTTCCCGGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-7604s21c1
Sequence:CCGGAGATTTGGTTTGGGATCAATACTCGAGTATTGATCCCAAACCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-1422s21c1
Sequence:CCGGTGCAGCACAACTTCGAATTATCTCGAGATAATTCGAAGTTGTGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002026
VALIDATED
FN1 MISSION shRNA Lentiviral Transduction Particles
fibronectin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002026.1-417s1c1
Sequence:CCGGCGGTTGTTATGACAATGGAAACTCGAGTTTCCATTGTCATAACAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002026.1-6799s1c1
Sequence:CCGGCCCTACACAGTTTCCCATTATCTCGAGATAATGGGAAACTGTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002026.1-3591s1c1
Sequence:CCGGGCCTGCTCCAAGAATTGGTTTCTCGAGAAACCAATTCTTGGAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002026.1-2250s1c1
Sequence:CCGGCCACTTAAACTCCTACACCATCTCGAGATGGTGTAGGAGTTTAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-5594s21c1
Sequence:CCGGCGTGGTTGTATCAGGACTTATCTCGAGATAAGTCCTGATACAACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-3590s21c1
Sequence:CCGGGCCTGCTCCAAGAATTGGTTTCTCGAGAAACCAATTCTTGGAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-6154s21c1
Sequence:CCGGTGGAACCGGGAACCGAATATACTCGAGTATATTCGGTTCCCGGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-7604s21c1
Sequence:CCGGAGATTTGGTTTGGGATCAATACTCGAGTATTGATCCCAAACCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002026.2-1422s21c1
Sequence:CCGGTGCAGCACAACTTCGAATTATCTCGAGATAATTCGAAGTTGTGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129845
VALIDATED
FN1 MISSION shRNA Bacterial Glycerol Stock
fibronectin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129845.3-8108s1c1
Sequence:CCGGGCCTAGAAATACCTTTCTCTTCTCGAGAAGAGAAAGGTATTTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129845.3-6242s1c1
Sequence:CCGGGCCAGGATTACTGGCTACATTCTCGAGAATGTAGCCAGTAATCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129845.3-4054s1c1
Sequence:CCGGGCTAAACTCTTCCACCATTATCTCGAGATAATGGTGGAAGAGTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129845.3-3050s1c1
Sequence:CCGGCCTGTCAACAGAAATACCTTTCTCGAGAAAGGTATTTCTGTTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129845.3-5056s1c1
Sequence:CCGGGCCAGTTTCCATCAATTATAACTCGAGTTATAATTGATGGAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129845
VALIDATED
FN1 MISSION shRNA shRNA Plasmid DNA
fibronectin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129845.3-8108s1c1
Sequence:CCGGGCCTAGAAATACCTTTCTCTTCTCGAGAAGAGAAAGGTATTTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129845.3-6242s1c1
Sequence:CCGGGCCAGGATTACTGGCTACATTCTCGAGAATGTAGCCAGTAATCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129845.3-4054s1c1
Sequence:CCGGGCTAAACTCTTCCACCATTATCTCGAGATAATGGTGGAAGAGTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129845.3-3050s1c1
Sequence:CCGGCCTGTCAACAGAAATACCTTTCTCGAGAAAGGTATTTCTGTTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129845.3-5056s1c1
Sequence:CCGGGCCAGTTTCCATCAATTATAACTCGAGTTATAATTGATGGAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129845
VALIDATED
FN1 MISSION shRNA Lentiviral Transduction Particles
fibronectin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129845.3-8108s1c1
Sequence:CCGGGCCTAGAAATACCTTTCTCTTCTCGAGAAGAGAAAGGTATTTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129845.3-6242s1c1
Sequence:CCGGGCCAGGATTACTGGCTACATTCTCGAGAATGTAGCCAGTAATCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129845.3-4054s1c1
Sequence:CCGGGCTAAACTCTTCCACCATTATCTCGAGATAATGGTGGAAGAGTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129845.3-3050s1c1
Sequence:CCGGCCTGTCAACAGAAATACCTTTCTCGAGAAAGGTATTTCTGTTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129845.3-5056s1c1
Sequence:CCGGGCCAGTTTCCATCAATTATAACTCGAGTTATAATTGATGGAAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010233
VALIDATED
FN1 MISSION shRNA Bacterial Glycerol Stock
fibronectin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-5055s21c1
Sequence:CCGGGCCAGTTTCCATCAATTATAACTCGAGTTATAATTGATGGAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-8107s21c1
Sequence:CCGGGCCTAGAAATACCTTTCTCTTCTCGAGAAGAGAAAGGTATTTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-1050s21c1
Sequence:CCGGTGATGTCCGAACAGCTATTTACTCGAGTAAATAGCTGTTCGGACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-4872s21c1
Sequence:CCGGTGCCGTCTCTGTGCGCTATTACTCGAGTAATAGCGCACAGAGACGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-3049s21c1
Sequence:CCGGCCTGTCAACAGAAATACCTTTCTCGAGAAAGGTATTTCTGTTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010233
VALIDATED
FN1 MISSION shRNA shRNA Plasmid DNA
fibronectin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-5055s21c1
Sequence:CCGGGCCAGTTTCCATCAATTATAACTCGAGTTATAATTGATGGAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-8107s21c1
Sequence:CCGGGCCTAGAAATACCTTTCTCTTCTCGAGAAGAGAAAGGTATTTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-1050s21c1
Sequence:CCGGTGATGTCCGAACAGCTATTTACTCGAGTAAATAGCTGTTCGGACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-4872s21c1
Sequence:CCGGTGCCGTCTCTGTGCGCTATTACTCGAGTAATAGCGCACAGAGACGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-3049s21c1
Sequence:CCGGCCTGTCAACAGAAATACCTTTCTCGAGAAAGGTATTTCTGTTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010233
VALIDATED
FN1 MISSION shRNA Lentiviral Transduction Particles
fibronectin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-5055s21c1
Sequence:CCGGGCCAGTTTCCATCAATTATAACTCGAGTTATAATTGATGGAAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-8107s21c1
Sequence:CCGGGCCTAGAAATACCTTTCTCTTCTCGAGAAGAGAAAGGTATTTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-1050s21c1
Sequence:CCGGTGATGTCCGAACAGCTATTTACTCGAGTAAATAGCTGTTCGGACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-4872s21c1
Sequence:CCGGTGCCGTCTCTGTGCGCTATTACTCGAGTAATAGCGCACAGAGACGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010233.1-3049s21c1
Sequence:CCGGCCTGTCAACAGAAATACCTTTCTCGAGAAAGGTATTTCTGTTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)