EMAIL THIS PAGE TO A FRIEND

FN3K

fructosamine 3 kinase

UniProtKB ID: Q9H479
Gene ID:
Human(64122) Summary: A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way, fructosamines, are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of fructosamines which may result in deglycation. [provided by RefSeq, Feb 2012]
Mouse(63828) fructosamine 3 kinase
Rat(498034) fructosamine 3 kinase
chicken(417335) fructosamine 3 kinase
domestic cat(101093222) fructosamine 3 kinase
cow(539709) fructosamine 3 kinase
dog(608337) fructosamine 3 kinase
naked mole-rat(101712216) fructosamine 3 kinase
domestic guinea pig(100718567) fructosamine 3 kinase
sheep(101108403) fructosamine 3 kinase
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022158 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027251 MISSION® esiRNA esiRNA human FN3K (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022158 Rosetta Predictions human pricing
NM_001109051 Rosetta Predictions rat pricing
NM_001038699 Rosetta Predictions mouse pricing
NM_022014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142591 predicted 383
2 SASI_Hs01_00142592 predicted 249
3 SASI_Hs01_00142593 predicted 306
4 SASI_Hs01_00142594 predicted 450
5 SASI_Hs01_00142595 predicted 219
6 SASI_Hs01_00142596 predicted 486
7 SASI_Hs01_00142597 predicted 594
8 SASI_Hs01_00142598 predicted 711
9 SASI_Hs01_00142599 predicted 373
10 SASI_Hs01_00142600 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244640 predicted 417
2 SASI_Rn02_00244641 predicted 440
3 SASI_Rn02_00244642 predicted 217
4 SASI_Rn02_00244643 predicted 286
5 SASI_Rn02_00244644 predicted 428
6 SASI_Rn02_00244645 predicted 226
7 SASI_Rn02_00244646 predicted 270
8 SASI_Rn02_00244647 predicted 274
9 SASI_Rn02_00244648 predicted 251
10 SASI_Rn02_00244649 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289675 predicted 888
2 SASI_Mm02_00289676 predicted 513
3 SASI_Mm02_00289677 predicted 993
4 SASI_Mm02_00289678 predicted 808
5 SASI_Mm02_00289679 predicted 438
6 SASI_Mm02_00289680 predicted 742
7 SASI_Mm02_00289681 predicted 233
8 SASI_Mm02_00289682 predicted 976
9 SASI_Mm02_00289683 predicted 608
10 SASI_Mm02_00289684 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120515 predicted 297
2 SASI_Mm01_00120516 predicted 539
3 SASI_Mm02_00326486 predicted 723
4 SASI_Mm01_00120517 predicted 626
5 SASI_Mm01_00120518 predicted 439
6 SASI_Mm01_00120519 predicted 337
7 SASI_Mm02_00326487 predicted 463
8 SASI_Mm01_00120520 predicted 527
9 SASI_Mm01_00120523 predicted 536
10 SASI_Mm01_00120524 predicted 617
11 SASI_Mm01_00120521 predicted 436
12 SASI_Mm01_00120522 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022014
FN3K MISSION shRNA Bacterial Glycerol Stock
fructosamine 3 kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022014.4-713s21c1
Sequence:CCGGATGACCAGGGACCCGTAATTTCTCGAGAAATTACGGGTCCCTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022014.4-637s21c1
Sequence:CCGGCCGGATCTGTTTGCGGGTATACTCGAGTATACCCGCAAACAGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022014.4-322s21c1
Sequence:CCGGCTTAGCAGTCAGGCATCAAAGCTCGAGCTTTGATGCCTGACTGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022014.4-773s21c1
Sequence:CCGGTGGCCATTGCATCGATGTTTGCTCGAGCAAACATCGATGCAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-862s1c1
Sequence:CCGGCCAGCTCTTTAACTACCTAAACTCGAGTTTAGGTAGTTAAAGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-711s1c1
Sequence:CCGGCCGTAATTTATGATCCAGCCTCTCGAGAGGCTGGATCATAAATTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-131s1c1
Sequence:CCGGCCCGTGTTTGTCAAGGTCAATCTCGAGATTGACCTTGACAAACACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-541s1c1
Sequence:CCGGCCAAGCTCAGTTGGATCTCATCTCGAGATGAGATCCAACTGAGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-344s1c1
Sequence:CCGGGCAGACCTGCACCTTTACAATCTCGAGATTGTAAAGGTGCAGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022014
FN3K MISSION shRNA shRNA Plasmid DNA
fructosamine 3 kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022014.4-713s21c1
Sequence:CCGGATGACCAGGGACCCGTAATTTCTCGAGAAATTACGGGTCCCTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022014.4-637s21c1
Sequence:CCGGCCGGATCTGTTTGCGGGTATACTCGAGTATACCCGCAAACAGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022014.4-322s21c1
Sequence:CCGGCTTAGCAGTCAGGCATCAAAGCTCGAGCTTTGATGCCTGACTGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022014.4-773s21c1
Sequence:CCGGTGGCCATTGCATCGATGTTTGCTCGAGCAAACATCGATGCAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-862s1c1
Sequence:CCGGCCAGCTCTTTAACTACCTAAACTCGAGTTTAGGTAGTTAAAGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-711s1c1
Sequence:CCGGCCGTAATTTATGATCCAGCCTCTCGAGAGGCTGGATCATAAATTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-131s1c1
Sequence:CCGGCCCGTGTTTGTCAAGGTCAATCTCGAGATTGACCTTGACAAACACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-541s1c1
Sequence:CCGGCCAAGCTCAGTTGGATCTCATCTCGAGATGAGATCCAACTGAGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-344s1c1
Sequence:CCGGGCAGACCTGCACCTTTACAATCTCGAGATTGTAAAGGTGCAGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022014
FN3K MISSION shRNA Lentiviral Transduction Particles
fructosamine 3 kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022014.4-713s21c1
Sequence:CCGGATGACCAGGGACCCGTAATTTCTCGAGAAATTACGGGTCCCTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022014.4-637s21c1
Sequence:CCGGCCGGATCTGTTTGCGGGTATACTCGAGTATACCCGCAAACAGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022014.4-322s21c1
Sequence:CCGGCTTAGCAGTCAGGCATCAAAGCTCGAGCTTTGATGCCTGACTGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022014.4-773s21c1
Sequence:CCGGTGGCCATTGCATCGATGTTTGCTCGAGCAAACATCGATGCAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-862s1c1
Sequence:CCGGCCAGCTCTTTAACTACCTAAACTCGAGTTTAGGTAGTTAAAGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-711s1c1
Sequence:CCGGCCGTAATTTATGATCCAGCCTCTCGAGAGGCTGGATCATAAATTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-131s1c1
Sequence:CCGGCCCGTGTTTGTCAAGGTCAATCTCGAGATTGACCTTGACAAACACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-541s1c1
Sequence:CCGGCCAAGCTCAGTTGGATCTCATCTCGAGATGAGATCCAACTGAGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022014.1-344s1c1
Sequence:CCGGGCAGACCTGCACCTTTACAATCTCGAGATTGTAAAGGTGCAGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022158
FN3K MISSION shRNA Bacterial Glycerol Stock
fructosamine 3 kinase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022158.2-594s1c1
Sequence:CCGGCAGGTGAAGATCCCGGATCTGCTCGAGCAGATCCGGGATCTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022158.2-773s1c1
Sequence:CCGGCAGATCCTTCTTCACCGCCTACTCGAGTAGGCGGTGAAGAAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-108s1c1
Sequence:CCGGGCAGGCCCAGTGTTCGTCAAACTCGAGTTTGACGAACACTGGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-860s1c1
Sequence:CCGGCCTGAACCACTGGAACCACTTCTCGAGAAGTGGTTCCAGTGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-273s1c1
Sequence:CCGGCATTTGAAGATGAAGAGCTTGCTCGAGCAAGCTCTTCATCTTCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-222s1c1
Sequence:CCGGCCCATGAAGGTCATCGACCTGCTCGAGCAGGTCGATGACCTTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-323s1c1
Sequence:CCGGGATGGCAGATTTGCATCTTTACTCGAGTAAAGATGCAAATCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-694s1c1
Sequence:CCGGCCATTATTTACGACCCGGCTTCTCGAGAAGCCGGGTCGTAAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-413s1c1
Sequence:CCGGGCCTCAGTATGTGGACAAGTTCTCGAGAACTTGTCCACATACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-848s1c1
Sequence:CCGGGCTGTTTAACTACCTGAACCACTCGAGTGGTTCAGGTAGTTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-537s1c1
Sequence:CCGGGACCTCATTGAGAAGGACTATCTCGAGATAGTCCTTCTCAATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-257s1c1
Sequence:CCGGCGCCTTTGTGATGGAGCATTTCTCGAGAAATGCTCCATCACAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022158
FN3K MISSION shRNA shRNA Plasmid DNA
fructosamine 3 kinase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022158.2-594s1c1
Sequence:CCGGCAGGTGAAGATCCCGGATCTGCTCGAGCAGATCCGGGATCTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022158.2-773s1c1
Sequence:CCGGCAGATCCTTCTTCACCGCCTACTCGAGTAGGCGGTGAAGAAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-108s1c1
Sequence:CCGGGCAGGCCCAGTGTTCGTCAAACTCGAGTTTGACGAACACTGGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-860s1c1
Sequence:CCGGCCTGAACCACTGGAACCACTTCTCGAGAAGTGGTTCCAGTGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-273s1c1
Sequence:CCGGCATTTGAAGATGAAGAGCTTGCTCGAGCAAGCTCTTCATCTTCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-222s1c1
Sequence:CCGGCCCATGAAGGTCATCGACCTGCTCGAGCAGGTCGATGACCTTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-323s1c1
Sequence:CCGGGATGGCAGATTTGCATCTTTACTCGAGTAAAGATGCAAATCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-694s1c1
Sequence:CCGGCCATTATTTACGACCCGGCTTCTCGAGAAGCCGGGTCGTAAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-413s1c1
Sequence:CCGGGCCTCAGTATGTGGACAAGTTCTCGAGAACTTGTCCACATACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-848s1c1
Sequence:CCGGGCTGTTTAACTACCTGAACCACTCGAGTGGTTCAGGTAGTTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-537s1c1
Sequence:CCGGGACCTCATTGAGAAGGACTATCTCGAGATAGTCCTTCTCAATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-257s1c1
Sequence:CCGGCGCCTTTGTGATGGAGCATTTCTCGAGAAATGCTCCATCACAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022158
FN3K MISSION shRNA Lentiviral Transduction Particles
fructosamine 3 kinase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022158.2-594s1c1
Sequence:CCGGCAGGTGAAGATCCCGGATCTGCTCGAGCAGATCCGGGATCTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022158.2-773s1c1
Sequence:CCGGCAGATCCTTCTTCACCGCCTACTCGAGTAGGCGGTGAAGAAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-108s1c1
Sequence:CCGGGCAGGCCCAGTGTTCGTCAAACTCGAGTTTGACGAACACTGGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-860s1c1
Sequence:CCGGCCTGAACCACTGGAACCACTTCTCGAGAAGTGGTTCCAGTGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-273s1c1
Sequence:CCGGCATTTGAAGATGAAGAGCTTGCTCGAGCAAGCTCTTCATCTTCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-222s1c1
Sequence:CCGGCCCATGAAGGTCATCGACCTGCTCGAGCAGGTCGATGACCTTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-323s1c1
Sequence:CCGGGATGGCAGATTTGCATCTTTACTCGAGTAAAGATGCAAATCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-694s1c1
Sequence:CCGGCCATTATTTACGACCCGGCTTCTCGAGAAGCCGGGTCGTAAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-413s1c1
Sequence:CCGGGCCTCAGTATGTGGACAAGTTCTCGAGAACTTGTCCACATACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-848s1c1
Sequence:CCGGGCTGTTTAACTACCTGAACCACTCGAGTGGTTCAGGTAGTTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-537s1c1
Sequence:CCGGGACCTCATTGAGAAGGACTATCTCGAGATAGTCCTTCTCAATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022158.2-257s1c1
Sequence:CCGGCGCCTTTGTGATGGAGCATTTCTCGAGAAATGCTCCATCACAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks