EMAIL THIS PAGE TO A FRIEND

FNBP1

formin binding protein 1

70 Gene Product Result for
Synonyms: FBP17
Gene ID:
Human(23048) Summary: The protein encoded by this gene is a member of the formin-binding-protein family. The protein contains an N-terminal Fer/Cdc42-interacting protein 4 (CIP4) homology (FCH) domain followed by a coiled-coil domain, a proline-rich motif, a second coiled-coil domain, a Rho family protein-binding domain (RBD), and a C-terminal SH3 domain. This protein binds sorting nexin 2 (SNX2), tankyrase (TNKS), and dynamin; an interaction between this protein and formin has not been demonstrated yet in human. [provided by RefSeq, Jul 2008]
Mouse(14269) formin binding protein 1
Rat(192348) formin binding protein 1
Zebrafish(558990) formin binding protein 1
domestic cat(101086684) formin binding protein 1
cow(538717) formin binding protein 1
Horse(100069871) formin binding protein 1
dog(480695) formin binding protein 1
chicken(417187) formin binding protein 1
naked mole-rat(101698478) formin binding protein 1
domestic guinea pig(100732668) formin binding protein 1
sheep(101115265) formin binding protein 1
Domestic Rabbit(100009502) formin binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015033 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015033 Rosetta Predictions human pricing
NM_138914 Rosetta Predictions rat pricing
NM_001038700 Rosetta Predictions mouse pricing
NM_019406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221242 predicted 1902
2 SASI_Hs01_00221243 predicted 520
3 SASI_Hs01_00221244 predicted 1614
4 SASI_Hs01_00221245 predicted 1932
5 SASI_Hs01_00221246 predicted 494
6 SASI_Hs01_00221247 predicted 1886
7 SASI_Hs01_00221248 predicted 1910
8 SASI_Hs01_00221249 predicted 637
9 SASI_Hs02_00346844 predicted 451
10 SASI_Hs01_00221251 predicted 367
11 SASI_Hs01_00221250 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100856 predicted 733
2 SASI_Rn01_00100857 predicted 1496
3 SASI_Rn01_00100858 predicted 662
4 SASI_Rn01_00100859 predicted 548
5 SASI_Rn01_00100860 predicted 414
6 SASI_Rn01_00100861 predicted 1485
7 SASI_Rn01_00100862 predicted 265
8 SASI_Rn02_00268397 predicted 329
9 SASI_Rn01_00100863 predicted 565
10 SASI_Rn01_00100864 predicted 478
11 SASI_Rn01_00100865 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061427 predicted 761
2 SASI_Mm02_00289685 predicted 933
3 SASI_Mm02_00289686 predicted 332
4 SASI_Mm02_00289687 predicted 590
5 SASI_Mm02_00289688 predicted 932
6 SASI_Mm02_00289689 predicted 226
7 SASI_Mm01_00061433 predicted 227
8 SASI_Mm01_00061434 predicted 766
9 SASI_Mm02_00289690 predicted 558
10 SASI_Mm02_00289691 predicted 310
11 SASI_Mm01_00061426 predicted 1005
12 SASI_Mm01_00061428 predicted 1701
13 SASI_Mm01_00061429 predicted 1292
14 SASI_Mm01_00061430 predicted 726
15 SASI_Mm01_00061431 predicted 1073
16 SASI_Mm01_00061432 predicted 1039
17 SASI_Mm01_00061435 predicted 1687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100968 predicted 758
2 SASI_Mm01_00100969 predicted 939
3 SASI_Mm01_00100972 predicted 326
4 SASI_Mm02_00324330 predicted 595
5 SASI_Mm02_00324331 predicted 932
6 SASI_Mm01_00100973 predicted 226
7 SASI_Mm01_00100974 predicted 225
8 SASI_Mm01_00100975 predicted 766
9 SASI_Mm01_00100976 predicted 562
10 SASI_Mm01_00100977 predicted 304
11 SASI_Mm01_00100970 predicted 804
12 SASI_Mm01_00100971 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019406
VALIDATED
FNBP1 MISSION shRNA Bacterial Glycerol Stock
formin binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019406.2-1303s21c1
Sequence:CCGGGTTAGTGTGCTGCGTTCAATTCTCGAGAATTGAACGCAGCACACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019406.2-299s21c1
Sequence:CCGGTCAAGGAGAGGACGGAGATTGCTCGAGCAATCTCCGTCCTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019406.2-418s21c1
Sequence:CCGGGCCTTTCTTTCCACCCTGAATCTCGAGATTCAGGGTGGAAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019406.2-1003s21c1
Sequence:CCGGCTGGTCGTAGAAGCCTATAAGCTCGAGCTTATAGGCTTCTACGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019406.2-866s21c1
Sequence:CCGGAGAGGCGGATTGTGCGTATTGCTCGAGCAATACGCACAATCCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019406.1-1674s1c1
Sequence:CCGGCGTGTTTACCTCTGGCTTAAACTCGAGTTTAAGCCAGAGGTAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019406.1-296s1c1
Sequence:CCGGCCAACCTAAGAAGAACTCGAACTCGAGTTCGAGTTCTTCTTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019406.1-351s1c1
Sequence:CCGGGCCTTTCTTTCCACCCTGAATCTCGAGATTCAGGGTGGAAAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019406.1-731s1c1
Sequence:CCGGCCAGGAGCAATGGGAATACTACTCGAGTAGTATTCCCATTGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019406
VALIDATED
FNBP1 MISSION shRNA shRNA Plasmid DNA
formin binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019406.2-1303s21c1
Sequence:CCGGGTTAGTGTGCTGCGTTCAATTCTCGAGAATTGAACGCAGCACACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019406.2-299s21c1
Sequence:CCGGTCAAGGAGAGGACGGAGATTGCTCGAGCAATCTCCGTCCTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019406.2-418s21c1
Sequence:CCGGGCCTTTCTTTCCACCCTGAATCTCGAGATTCAGGGTGGAAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019406.2-1003s21c1
Sequence:CCGGCTGGTCGTAGAAGCCTATAAGCTCGAGCTTATAGGCTTCTACGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019406.2-866s21c1
Sequence:CCGGAGAGGCGGATTGTGCGTATTGCTCGAGCAATACGCACAATCCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019406.1-1674s1c1
Sequence:CCGGCGTGTTTACCTCTGGCTTAAACTCGAGTTTAAGCCAGAGGTAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019406.1-296s1c1
Sequence:CCGGCCAACCTAAGAAGAACTCGAACTCGAGTTCGAGTTCTTCTTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019406.1-351s1c1
Sequence:CCGGGCCTTTCTTTCCACCCTGAATCTCGAGATTCAGGGTGGAAAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019406.1-731s1c1
Sequence:CCGGCCAGGAGCAATGGGAATACTACTCGAGTAGTATTCCCATTGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019406
VALIDATED
FNBP1 MISSION shRNA Lentiviral Transduction Particles
formin binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019406.2-1303s21c1
Sequence:CCGGGTTAGTGTGCTGCGTTCAATTCTCGAGAATTGAACGCAGCACACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019406.2-299s21c1
Sequence:CCGGTCAAGGAGAGGACGGAGATTGCTCGAGCAATCTCCGTCCTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019406.2-418s21c1
Sequence:CCGGGCCTTTCTTTCCACCCTGAATCTCGAGATTCAGGGTGGAAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019406.2-1003s21c1
Sequence:CCGGCTGGTCGTAGAAGCCTATAAGCTCGAGCTTATAGGCTTCTACGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019406.2-866s21c1
Sequence:CCGGAGAGGCGGATTGTGCGTATTGCTCGAGCAATACGCACAATCCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019406.1-1674s1c1
Sequence:CCGGCGTGTTTACCTCTGGCTTAAACTCGAGTTTAAGCCAGAGGTAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019406.1-296s1c1
Sequence:CCGGCCAACCTAAGAAGAACTCGAACTCGAGTTCGAGTTCTTCTTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019406.1-351s1c1
Sequence:CCGGGCCTTTCTTTCCACCCTGAATCTCGAGATTCAGGGTGGAAAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019406.1-731s1c1
Sequence:CCGGCCAGGAGCAATGGGAATACTACTCGAGTAGTATTCCCATTGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015033
VALIDATED
FNBP1 MISSION shRNA Bacterial Glycerol Stock
formin binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015033.2-1571s21c1
Sequence:CCGGCAGCCAGTTTGGATCACAAATCTCGAGATTTGTGATCCAAACTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015033.2-346s21c1
Sequence:CCGGGCAAAGCAACTCAGGAATCTTCTCGAGAAGATTCCTGAGTTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015033.2-477s21c1
Sequence:CCGGGCATGAAGTTATCTCCGAGAACTCGAGTTCTCGGAGATAACTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015033.2-529s21c1
Sequence:CCGGCGCTATGTTCAGGAACTGAAACTCGAGTTTCAGTTCCTGAACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015033.1-1457s1c1
Sequence:CCGGGATGGATCAAAGAGATGCCATCTCGAGATGGCATCTCTTTGATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015033.1-483s1c1
Sequence:CCGGCGCTATGTTCAGGAACTGAAACTCGAGTTTCAGTTCCTGAACATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015033.1-301s1c1
Sequence:CCGGCAAAGCAACTCAGGAATCTTTCTCGAGAAAGATTCCTGAGTTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015033.1-1525s1c1
Sequence:CCGGCAGCCAGTTTGGATCACAAATCTCGAGATTTGTGATCCAAACTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015033.1-431s1c1
Sequence:CCGGGCATGAAGTTATCTCCGAGAACTCGAGTTCTCGGAGATAACTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015033.1-300s1c1
Sequence:CCGGGCAAAGCAACTCAGGAATCTTCTCGAGAAGATTCCTGAGTTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015033
VALIDATED
FNBP1 MISSION shRNA shRNA Plasmid DNA
formin binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015033.2-1571s21c1
Sequence:CCGGCAGCCAGTTTGGATCACAAATCTCGAGATTTGTGATCCAAACTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015033.2-346s21c1
Sequence:CCGGGCAAAGCAACTCAGGAATCTTCTCGAGAAGATTCCTGAGTTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015033.2-477s21c1
Sequence:CCGGGCATGAAGTTATCTCCGAGAACTCGAGTTCTCGGAGATAACTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015033.2-529s21c1
Sequence:CCGGCGCTATGTTCAGGAACTGAAACTCGAGTTTCAGTTCCTGAACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015033.1-1457s1c1
Sequence:CCGGGATGGATCAAAGAGATGCCATCTCGAGATGGCATCTCTTTGATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015033.1-483s1c1
Sequence:CCGGCGCTATGTTCAGGAACTGAAACTCGAGTTTCAGTTCCTGAACATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015033.1-301s1c1
Sequence:CCGGCAAAGCAACTCAGGAATCTTTCTCGAGAAAGATTCCTGAGTTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015033.1-1525s1c1
Sequence:CCGGCAGCCAGTTTGGATCACAAATCTCGAGATTTGTGATCCAAACTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015033.1-431s1c1
Sequence:CCGGGCATGAAGTTATCTCCGAGAACTCGAGTTCTCGGAGATAACTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015033.1-300s1c1
Sequence:CCGGGCAAAGCAACTCAGGAATCTTCTCGAGAAGATTCCTGAGTTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015033
VALIDATED
FNBP1 MISSION shRNA Lentiviral Transduction Particles
formin binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015033.2-1571s21c1
Sequence:CCGGCAGCCAGTTTGGATCACAAATCTCGAGATTTGTGATCCAAACTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015033.2-346s21c1
Sequence:CCGGGCAAAGCAACTCAGGAATCTTCTCGAGAAGATTCCTGAGTTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015033.2-477s21c1
Sequence:CCGGGCATGAAGTTATCTCCGAGAACTCGAGTTCTCGGAGATAACTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015033.2-529s21c1
Sequence:CCGGCGCTATGTTCAGGAACTGAAACTCGAGTTTCAGTTCCTGAACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015033.1-1457s1c1
Sequence:CCGGGATGGATCAAAGAGATGCCATCTCGAGATGGCATCTCTTTGATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015033.1-483s1c1
Sequence:CCGGCGCTATGTTCAGGAACTGAAACTCGAGTTTCAGTTCCTGAACATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015033.1-301s1c1
Sequence:CCGGCAAAGCAACTCAGGAATCTTTCTCGAGAAAGATTCCTGAGTTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015033.1-1525s1c1
Sequence:CCGGCAGCCAGTTTGGATCACAAATCTCGAGATTTGTGATCCAAACTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015033.1-431s1c1
Sequence:CCGGGCATGAAGTTATCTCCGAGAACTCGAGTTCTCGGAGATAACTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015033.1-300s1c1
Sequence:CCGGGCAAAGCAACTCAGGAATCTTCTCGAGAAGATTCCTGAGTTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks