EMAIL THIS PAGE TO A FRIEND

FNBP1L

formin binding protein 1-like

253 Gene Product Result for
Synonyms: C1orf39 TOCA1
UniProtKB ID: Q5T0N5, Q5T0N6, Q6B097, Q6P653, Q6R4Q4, Q9NXG1
Gene ID:
Human(54874) Summary: The protein encoded by this gene binds to both CDC42 and N-WASP. This protein promotes CDC42-induced actin polymerization by activating the N-WASP-WIP complex and, therefore, is involved in a pathway that links cell surface signals to the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(214459) formin binding protein 1-like
Rat(310839) formin binding protein 1-like
sheep(101106379) formin binding protein 1-like
Domestic Rabbit(100338578) formin binding protein 1-like
domestic guinea pig(100724617) formin binding protein 1-like
naked mole-rat(101705474) formin binding protein 1-like
Zebrafish(445240) formin binding protein 1-like
chicken(424495) formin binding protein 1-like
cow(616665) formin binding protein 1-like
Horse(100059052) formin binding protein 1-like
domestic cat(101099064) formin binding protein 1-like
dog(479942) formin binding protein 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017737 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024948 Rosetta Predictions human pricing
NM_017737 Rosetta Predictions human pricing
NM_001039609 Rosetta Predictions rat pricing
NM_001114665 Rosetta Predictions mouse pricing
NM_153118 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307288 predicted 251
2 SASI_Hs02_00307289 predicted 762
3 SASI_Hs01_00012846 predicted 1202
4 SASI_Hs01_00012848 predicted 1152
5 SASI_Hs01_00012849 predicted 1052
6 SASI_Hs01_00012850 predicted 854
7 SASI_Hs01_00012851 predicted 515
8 SASI_Hs01_00012852 predicted 642
9 SASI_Hs01_00012853 predicted 966
10 SASI_Hs02_00307290 predicted 740
11 SASI_Hs01_00012844 predicted 309
12 SASI_Hs01_00012845 predicted 874
13 SASI_Hs01_00012847 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350526 predicted 255
2 SASI_Hs02_00350527 predicted 766
3 SASI_Hs01_00127087 predicted 1202
4 SASI_Hs01_00127089 predicted 1154
5 SASI_Hs01_00127090 predicted 1051
6 SASI_Hs01_00127091 predicted 861
7 SASI_Hs01_00127092 predicted 518
8 SASI_Hs01_00127093 predicted 644
9 SASI_Hs01_00127094 predicted 963
10 SASI_Hs02_00350528 predicted 740
11 SASI_Hs01_00127085 predicted 311
12 SASI_Hs01_00127086 predicted 881
13 SASI_Hs01_00127088 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090663 predicted 726
2 SASI_Rn02_00204862 predicted 680
3 SASI_Rn01_00090664 predicted 636
4 SASI_Rn01_00090665 predicted 1060
5 SASI_Rn01_00090666 predicted 1511
6 SASI_Rn01_00090667 predicted 1036
7 SASI_Rn01_00090668 predicted 1111
8 SASI_Rn01_00090669 predicted 1461
9 SASI_Rn01_00090670 predicted 1165
10 SASI_Rn01_00090671 predicted 360
11 SASI_Rn01_00090672 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308797 predicted 630
2 SASI_Mm02_00308798 predicted 1688
3 SASI_Mm02_00308799 predicted 290
4 SASI_Mm02_00308800 predicted 1916
5 SASI_Mm02_00308801 predicted 420
6 SASI_Mm02_00308802 predicted 1626
7 SASI_Mm02_00308803 predicted 811
8 SASI_Mm02_00308804 predicted 1583
9 SASI_Mm02_00308805 predicted 1929
10 SASI_Mm02_00308806 predicted 1989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342977 predicted 635
2 SASI_Mm01_00096686 predicted 1518
3 SASI_Mm02_00342978 predicted 290
4 SASI_Mm01_00096688 predicted 1744
5 SASI_Mm02_00342979 predicted 422
6 SASI_Mm01_00096692 predicted 1448
7 SASI_Mm01_00096693 predicted 820
8 SASI_Mm02_00342980 predicted 1408
9 SASI_Mm02_00342981 predicted 1747
10 SASI_Mm02_00342982 predicted 1807
11 SASI_Mm01_00096684 predicted 290
12 SASI_Mm01_00096685 predicted 816
13 SASI_Mm01_00096687 predicted 868
14 SASI_Mm01_00096689 predicted 264
15 SASI_Mm01_00096690 predicted 326
16 SASI_Mm01_00096691 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153118
FNBP1L MISSION shRNA Bacterial Glycerol Stock
formin binding protein 1-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153118.1-309s1c1
Sequence:CCGGGCAGACTCAGAACGCAAAGTTCTCGAGAACTTTGCGTTCTGAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153118.1-1680s1c1
Sequence:CCGGGCGAGAAGTAATAGTTGGATACTCGAGTATCCAACTATTACTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153118.1-1237s1c1
Sequence:CCGGGCAGTAAAGGTGCAGTAACTTCTCGAGAAGTTACTGCACCTTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153118.1-779s1c1
Sequence:CCGGGCCTAAATTAGCAGAGACCATCTCGAGATGGTCTCTGCTAATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153118
FNBP1L MISSION shRNA shRNA Plasmid DNA
formin binding protein 1-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153118.1-309s1c1
Sequence:CCGGGCAGACTCAGAACGCAAAGTTCTCGAGAACTTTGCGTTCTGAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153118.1-1680s1c1
Sequence:CCGGGCGAGAAGTAATAGTTGGATACTCGAGTATCCAACTATTACTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153118.1-1237s1c1
Sequence:CCGGGCAGTAAAGGTGCAGTAACTTCTCGAGAAGTTACTGCACCTTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153118.1-779s1c1
Sequence:CCGGGCCTAAATTAGCAGAGACCATCTCGAGATGGTCTCTGCTAATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153118
FNBP1L MISSION shRNA Lentiviral Transduction Particles
formin binding protein 1-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153118.1-309s1c1
Sequence:CCGGGCAGACTCAGAACGCAAAGTTCTCGAGAACTTTGCGTTCTGAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153118.1-1680s1c1
Sequence:CCGGGCGAGAAGTAATAGTTGGATACTCGAGTATCCAACTATTACTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153118.1-1237s1c1
Sequence:CCGGGCAGTAAAGGTGCAGTAACTTCTCGAGAAGTTACTGCACCTTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153118.1-779s1c1
Sequence:CCGGGCCTAAATTAGCAGAGACCATCTCGAGATGGTCTCTGCTAATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017737
VALIDATED
FNBP1L MISSION shRNA Bacterial Glycerol Stock
formin binding protein 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017737.2-1333s1c1
Sequence:CCGGGAGGGAAGTTACACTGATGATCTCGAGATCATCAGTGTAACTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017737.2-386s1c1
Sequence:CCGGGCTGGAAACAGATGGATAATACTCGAGTATTATCCATCTGTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017737.2-1205s1c1
Sequence:CCGGGCCTACGAATGGAAATCCATACTCGAGTATGGATTTCCATTCGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017737.2-878s1c1
Sequence:CCGGCCATTTCTGATGGGACTATCACTCGAGTGATAGTCCCATCAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017737.2-1050s1c1
Sequence:CCGGGCAGCGCATTGATGAACTTAACTCGAGTTAAGTTCATCAATGCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017737.2-115s1c1
Sequence:CCGGGAACAGAACTATGCGAAACAACTCGAGTTGTTTCGCATAGTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017737.4-1935s21c1
Sequence:CCGGTACTAACTTCATTAGCATTTCCTCGAGGAAATGCTAATGAAGTTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017737.4-1310s21c1
Sequence:CCGGGGGAGTTTGCAGCCTAAATTACTCGAGTAATTTAGGCTGCAAACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017737.4-673s21c1
Sequence:CCGGGTTGAATCTGCGTACGCATATCTCGAGATATGCGTACGCAGATTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017737
VALIDATED
FNBP1L MISSION shRNA shRNA Plasmid DNA
formin binding protein 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017737.2-1333s1c1
Sequence:CCGGGAGGGAAGTTACACTGATGATCTCGAGATCATCAGTGTAACTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017737.2-386s1c1
Sequence:CCGGGCTGGAAACAGATGGATAATACTCGAGTATTATCCATCTGTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017737.2-1205s1c1
Sequence:CCGGGCCTACGAATGGAAATCCATACTCGAGTATGGATTTCCATTCGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017737.2-878s1c1
Sequence:CCGGCCATTTCTGATGGGACTATCACTCGAGTGATAGTCCCATCAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017737.2-1050s1c1
Sequence:CCGGGCAGCGCATTGATGAACTTAACTCGAGTTAAGTTCATCAATGCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017737.2-115s1c1
Sequence:CCGGGAACAGAACTATGCGAAACAACTCGAGTTGTTTCGCATAGTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017737.4-1935s21c1
Sequence:CCGGTACTAACTTCATTAGCATTTCCTCGAGGAAATGCTAATGAAGTTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017737.4-1310s21c1
Sequence:CCGGGGGAGTTTGCAGCCTAAATTACTCGAGTAATTTAGGCTGCAAACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017737.4-673s21c1
Sequence:CCGGGTTGAATCTGCGTACGCATATCTCGAGATATGCGTACGCAGATTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017737
VALIDATED
FNBP1L MISSION shRNA Lentiviral Transduction Particles
formin binding protein 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017737.2-1333s1c1
Sequence:CCGGGAGGGAAGTTACACTGATGATCTCGAGATCATCAGTGTAACTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017737.2-386s1c1
Sequence:CCGGGCTGGAAACAGATGGATAATACTCGAGTATTATCCATCTGTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017737.2-1205s1c1
Sequence:CCGGGCCTACGAATGGAAATCCATACTCGAGTATGGATTTCCATTCGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017737.2-878s1c1
Sequence:CCGGCCATTTCTGATGGGACTATCACTCGAGTGATAGTCCCATCAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017737.2-1050s1c1
Sequence:CCGGGCAGCGCATTGATGAACTTAACTCGAGTTAAGTTCATCAATGCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017737.2-115s1c1
Sequence:CCGGGAACAGAACTATGCGAAACAACTCGAGTTGTTTCGCATAGTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017737.4-1935s21c1
Sequence:CCGGTACTAACTTCATTAGCATTTCCTCGAGGAAATGCTAATGAAGTTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017737.4-1310s21c1
Sequence:CCGGGGGAGTTTGCAGCCTAAATTACTCGAGTAATTTAGGCTGCAAACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017737.4-673s21c1
Sequence:CCGGGTTGAATCTGCGTACGCATATCTCGAGATATGCGTACGCAGATTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks