EMAIL THIS PAGE TO A FRIEND

FNBP4

formin binding protein 4

78 Gene Product Result for
Synonyms: FBP30
UniProtKB ID: Q8N3X1, Q9H985, Q9NT81, Q9Y2L7
Gene ID:
Mouse(55935) formin binding protein 4
Rat(311183) formin binding protein 4
Zebrafish(403074) formin binding protein 4
chicken(426631) formin binding protein 4
dog(483619) formin binding protein 4
cow(100336530) formin binding protein 4
domestic cat(101086343) formin binding protein 4
naked mole-rat(101726778) formin binding protein 4
domestic guinea pig(100729332) formin binding protein 4
sheep(101120014) formin binding protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015308 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015308 Rosetta Predictions human pricing
NM_001013159 Rosetta Predictions rat pricing
NM_018828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164296 predicted 1750
2 SASI_Hs01_00164297 predicted 1783
3 SASI_Hs01_00164298 predicted 501
4 SASI_Hs01_00164299 predicted 737
5 SASI_Hs01_00164300 predicted 1546
6 SASI_Hs01_00164301 predicted 1758
7 SASI_Hs01_00164302 predicted 1861
8 SASI_Hs01_00164303 predicted 1358
9 SASI_Hs01_00164304 predicted 1435
10 SASI_Hs01_00164305 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200888 predicted 3094
2 SASI_Rn02_00200889 predicted 468
3 SASI_Rn02_00200890 predicted 3016
4 SASI_Rn02_00200891 predicted 1789
5 SASI_Rn02_00200892 predicted 3270
6 SASI_Rn02_00200893 predicted 1235
7 SASI_Rn02_00200894 predicted 2766
8 SASI_Rn02_00200895 predicted 1552
9 SASI_Rn02_00200896 predicted 3256
10 SASI_Rn02_00200897 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134960 predicted 1880
2 SASI_Mm01_00134961 predicted 2864
3 SASI_Mm02_00324177 predicted 3351
4 SASI_Mm01_00134962 predicted 3113
5 SASI_Mm01_00134964 predicted 854
6 SASI_Mm01_00134965 predicted 621
7 SASI_Mm02_00324178 predicted 1845
8 SASI_Mm01_00134966 predicted 2664
9 SASI_Mm02_00324179 predicted 671
10 SASI_Mm01_00134968 predicted 2824
11 SASI_Mm01_00134963 predicted 1156
12 SASI_Mm01_00134967 predicted 1126
13 SASI_Mm01_00134969 predicted 2025
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015308
VALIDATED
FNBP4 MISSION shRNA Bacterial Glycerol Stock
formin binding protein 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_015308.2-3447s21c1
Sequence:CCGGACTTAGCATGTTAGGTGTATTCTCGAGAATACACCTAACATGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015308.2-1972s21c1
Sequence:CCGGAGGGATCATAGACGGTATTTCCTCGAGGAAATACCGTCTATGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015308.2-2842s21c1
Sequence:CCGGGTGCCTACCGCTACCATTATACTCGAGTATAATGGTAGCGGTAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015308.2-2453s21c1
Sequence:CCGGCCACAGTTGTAACTAGCCAGACTCGAGTCTGGCTAGTTACAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015308.1-3279s1c1
Sequence:CCGGGCTTTGACCATGCTGCCTTTACTCGAGTAAAGGCAGCATGGTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015308.1-3683s1c1
Sequence:CCGGCCCTCAAGTATGTGGCAGTAACTCGAGTTACTGCCACATACTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015308.1-2321s1c1
Sequence:CCGGCCACAGTTGTAACTAGCCAGACTCGAGTCTGGCTAGTTACAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015308.1-2946s1c1
Sequence:CCGGGAAGCGAATTGAAGAGTGGAACTCGAGTTCCACTCTTCAATTCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_015308.1-3650s1c1
Sequence:CCGGGCAGGTGTTCATATCCTTGATCTCGAGATCAAGGATATGAACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015308.1-3685s1c1
Sequence:CCGGCTCAAGTATGTGGCAGTAAATCTCGAGATTTACTGCCACATACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015308.1-376s1c1
Sequence:CCGGGATGACAATGATGTTTCCGAACTCGAGTTCGGAAACATCATTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015308.1-2623s1c1
Sequence:CCGGGCACCTGCAATTATGAGTTATCTCGAGATAACTCATAATTGCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015308
VALIDATED
FNBP4 MISSION shRNA shRNA Plasmid DNA
formin binding protein 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_015308.2-3447s21c1
Sequence:CCGGACTTAGCATGTTAGGTGTATTCTCGAGAATACACCTAACATGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015308.2-1972s21c1
Sequence:CCGGAGGGATCATAGACGGTATTTCCTCGAGGAAATACCGTCTATGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015308.2-2842s21c1
Sequence:CCGGGTGCCTACCGCTACCATTATACTCGAGTATAATGGTAGCGGTAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015308.2-2453s21c1
Sequence:CCGGCCACAGTTGTAACTAGCCAGACTCGAGTCTGGCTAGTTACAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015308.1-3279s1c1
Sequence:CCGGGCTTTGACCATGCTGCCTTTACTCGAGTAAAGGCAGCATGGTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015308.1-3683s1c1
Sequence:CCGGCCCTCAAGTATGTGGCAGTAACTCGAGTTACTGCCACATACTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015308.1-2321s1c1
Sequence:CCGGCCACAGTTGTAACTAGCCAGACTCGAGTCTGGCTAGTTACAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015308.1-2946s1c1
Sequence:CCGGGAAGCGAATTGAAGAGTGGAACTCGAGTTCCACTCTTCAATTCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_015308.1-3650s1c1
Sequence:CCGGGCAGGTGTTCATATCCTTGATCTCGAGATCAAGGATATGAACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015308.1-3685s1c1
Sequence:CCGGCTCAAGTATGTGGCAGTAAATCTCGAGATTTACTGCCACATACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015308.1-376s1c1
Sequence:CCGGGATGACAATGATGTTTCCGAACTCGAGTTCGGAAACATCATTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015308.1-2623s1c1
Sequence:CCGGGCACCTGCAATTATGAGTTATCTCGAGATAACTCATAATTGCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015308
VALIDATED
FNBP4 MISSION shRNA Lentiviral Transduction Particles
formin binding protein 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_015308.2-3447s21c1
Sequence:CCGGACTTAGCATGTTAGGTGTATTCTCGAGAATACACCTAACATGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015308.2-1972s21c1
Sequence:CCGGAGGGATCATAGACGGTATTTCCTCGAGGAAATACCGTCTATGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015308.2-2842s21c1
Sequence:CCGGGTGCCTACCGCTACCATTATACTCGAGTATAATGGTAGCGGTAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015308.2-2453s21c1
Sequence:CCGGCCACAGTTGTAACTAGCCAGACTCGAGTCTGGCTAGTTACAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015308.1-3279s1c1
Sequence:CCGGGCTTTGACCATGCTGCCTTTACTCGAGTAAAGGCAGCATGGTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015308.1-3683s1c1
Sequence:CCGGCCCTCAAGTATGTGGCAGTAACTCGAGTTACTGCCACATACTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015308.1-2321s1c1
Sequence:CCGGCCACAGTTGTAACTAGCCAGACTCGAGTCTGGCTAGTTACAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015308.1-2946s1c1
Sequence:CCGGGAAGCGAATTGAAGAGTGGAACTCGAGTTCCACTCTTCAATTCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_015308.1-3650s1c1
Sequence:CCGGGCAGGTGTTCATATCCTTGATCTCGAGATCAAGGATATGAACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015308.1-3685s1c1
Sequence:CCGGCTCAAGTATGTGGCAGTAAATCTCGAGATTTACTGCCACATACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015308.1-376s1c1
Sequence:CCGGGATGACAATGATGTTTCCGAACTCGAGTTCGGAAACATCATTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015308.1-2623s1c1
Sequence:CCGGGCACCTGCAATTATGAGTTATCTCGAGATAACTCATAATTGCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018828
VALIDATED
FNBP4 MISSION shRNA Bacterial Glycerol Stock
formin binding protein 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018828.2-3119s21c1
Sequence:CCGGAGAGTATCCAGCGGGAGTTAGCTCGAGCTAACTCCCGCTGGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018828.2-141s21c1
Sequence:CCGGACGGTTCATGAATATTGATTACTCGAGTAATCAATATTCATGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018828.2-683s1c1
Sequence:CCGGTAGCGGAGATAGACGCCATAACTCGAGTTATGGCGTCTATCTCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018828.2-2068s1c1
Sequence:CCGGAGGGATCATAGACGATATTTCCTCGAGGAAATATCGTCTATGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018828.2-1087s21c1
Sequence:CCGGACTGCTGCTTCCAGTAGTAAACTCGAGTTTACTACTGGAAGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018828.2-1585s21c1
Sequence:CCGGGTGCGTAGGATTATGTCTAAACTCGAGTTTAGACATAATCCTACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018828.2-4445s21c1
Sequence:CCGGAGTAATACAAAGCTGATTATGCTCGAGCATAATCAGCTTTGTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018828.1-3428s1c1
Sequence:CCGGGCATACAAAGTTGTCCATTTACTCGAGTAAATGGACAACTTTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018828.1-556s1c1
Sequence:CCGGCTGTGCTTACTTGGTGCTTATCTCGAGATAAGCACCAAGTAAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018828.1-4204s1c1
Sequence:CCGGGCCCATTCTTAGTTGTTCCAACTCGAGTTGGAACAACTAAGAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018828
VALIDATED
FNBP4 MISSION shRNA shRNA Plasmid DNA
formin binding protein 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018828.2-3119s21c1
Sequence:CCGGAGAGTATCCAGCGGGAGTTAGCTCGAGCTAACTCCCGCTGGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018828.2-141s21c1
Sequence:CCGGACGGTTCATGAATATTGATTACTCGAGTAATCAATATTCATGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018828.2-683s1c1
Sequence:CCGGTAGCGGAGATAGACGCCATAACTCGAGTTATGGCGTCTATCTCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018828.2-2068s1c1
Sequence:CCGGAGGGATCATAGACGATATTTCCTCGAGGAAATATCGTCTATGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018828.2-1087s21c1
Sequence:CCGGACTGCTGCTTCCAGTAGTAAACTCGAGTTTACTACTGGAAGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018828.2-1585s21c1
Sequence:CCGGGTGCGTAGGATTATGTCTAAACTCGAGTTTAGACATAATCCTACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018828.2-4445s21c1
Sequence:CCGGAGTAATACAAAGCTGATTATGCTCGAGCATAATCAGCTTTGTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018828.1-3428s1c1
Sequence:CCGGGCATACAAAGTTGTCCATTTACTCGAGTAAATGGACAACTTTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018828.1-556s1c1
Sequence:CCGGCTGTGCTTACTTGGTGCTTATCTCGAGATAAGCACCAAGTAAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018828.1-4204s1c1
Sequence:CCGGGCCCATTCTTAGTTGTTCCAACTCGAGTTGGAACAACTAAGAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018828
VALIDATED
FNBP4 MISSION shRNA Lentiviral Transduction Particles
formin binding protein 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018828.2-3119s21c1
Sequence:CCGGAGAGTATCCAGCGGGAGTTAGCTCGAGCTAACTCCCGCTGGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018828.2-141s21c1
Sequence:CCGGACGGTTCATGAATATTGATTACTCGAGTAATCAATATTCATGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_018828.2-683s1c1
Sequence:CCGGTAGCGGAGATAGACGCCATAACTCGAGTTATGGCGTCTATCTCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018828.2-2068s1c1
Sequence:CCGGAGGGATCATAGACGATATTTCCTCGAGGAAATATCGTCTATGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018828.2-1087s21c1
Sequence:CCGGACTGCTGCTTCCAGTAGTAAACTCGAGTTTACTACTGGAAGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018828.2-1585s21c1
Sequence:CCGGGTGCGTAGGATTATGTCTAAACTCGAGTTTAGACATAATCCTACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018828.2-4445s21c1
Sequence:CCGGAGTAATACAAAGCTGATTATGCTCGAGCATAATCAGCTTTGTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018828.1-3428s1c1
Sequence:CCGGGCATACAAAGTTGTCCATTTACTCGAGTAAATGGACAACTTTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018828.1-556s1c1
Sequence:CCGGCTGTGCTTACTTGGTGCTTATCTCGAGATAAGCACCAAGTAAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018828.1-4204s1c1
Sequence:CCGGGCCCATTCTTAGTTGTTCCAACTCGAGTTGGAACAACTAAGAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks