EMAIL THIS PAGE TO A FRIEND

FNDC1

fibronectin type III domain containing 1

82 Gene Product Result for
Synonyms: AGS8 FNDC2 MEL4B3 RP11-243O10.2 bA243O10.1 dJ322A24.1
Gene ID:
Mouse(68655) fibronectin type III domain containing 1
Rat(308099) fibronectin type III domain containing 1
domestic guinea pig(100718304) fibronectin type III domain containing 1
naked mole-rat(101718476) fibronectin type III domain containing 1
sheep(101110947) fibronectin type III domain containing 1
Zebrafish(557836) fibronectin type III domain containing 1
domestic cat(101096732) fibronectin type III domain containing 1
cow(783891) fibronectin type III domain containing 1
cow(514844) fibronectin type III domain containing 1
Horse(100050844) fibronectin type III domain containing 1
dog(484061) fibronectin type III domain containing 1
chicken(421589) fibronectin type III domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032532 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032532 Rosetta Predictions human pricing
NM_001038615 Rosetta Predictions rat pricing
NM_001081416 Rosetta Predictions mouse pricing
XM_985863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201837 predicted 5599
2 SASI_Hs01_00201838 predicted 1181
3 SASI_Hs02_00360040 predicted 1600
4 SASI_Hs02_00360041 predicted 4323
5 SASI_Hs01_00201839 predicted 835
6 SASI_Hs01_00201841 predicted 4144
7 SASI_Hs01_00201842 predicted 5451
8 SASI_Hs01_00201843 predicted 5412
9 SASI_Hs01_00201844 predicted 1074
10 SASI_Hs02_00360042 predicted 1568
11 SASI_Hs01_00201840 predicted 1005
12 SASI_Hs01_00201845 predicted 479
13 SASI_Hs01_00201846 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054403 predicted 4680
2 SASI_Rn01_00054404 predicted 2149
3 SASI_Rn01_00054405 predicted 1882
4 SASI_Rn01_00054407 predicted 465
5 SASI_Rn01_00054408 predicted 4862
6 SASI_Rn01_00054409 predicted 1551
7 SASI_Rn01_00054410 predicted 1506
8 SASI_Rn02_00204711 predicted 673
9 SASI_Rn02_00204712 predicted 4183
10 SASI_Rn02_00204713 predicted 855
11 SASI_Rn01_00054401 predicted 1041
12 SASI_Rn01_00054402 predicted 2609
13 SASI_Rn01_00054406 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298171 predicted 2458
2 SASI_Mm02_00298172 predicted 315
3 SASI_Mm02_00298173 predicted 3496
4 SASI_Mm02_00298174 predicted 4960
5 SASI_Mm02_00298175 predicted 4685
6 SASI_Mm02_00298176 predicted 1043
7 SASI_Mm02_00298177 predicted 5001
8 SASI_Mm02_00298178 predicted 568
9 SASI_Mm02_00298179 predicted 4870
10 SASI_Mm02_00298180 predicted 3471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266454 predicted 2459
2 SASI_Mm01_00266455 predicted 3497
3 SASI_Mm01_00266456 predicted 4963
4 SASI_Mm01_00266457 predicted 4690
5 SASI_Mm01_00266458 predicted 1042
6 SASI_Mm01_00266459 predicted 5011
7 SASI_Mm01_00266460 predicted 575
8 SASI_Mm01_00266461 predicted 4868
9 SASI_Mm01_00266462 predicted 3469
10 SASI_Mm01_00266463 predicted 2649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032532
FNDC1 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032532.2-1976s21c1
Sequence:CCGGCCGAAGGGAAGGCGTAGATAACTCGAGTTATCTACGCCTTCCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032532.2-5538s21c1
Sequence:CCGGGACTGCCATGGACGGCAATATCTCGAGATATTGCCGTCCATGGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032532.1-4316s1c1
Sequence:CCGGCCTCCAAGATTCACATGGAAACTCGAGTTTCCATGTGAATCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032532.1-472s1c1
Sequence:CCGGCGGAGACATACTCCTTCCTTACTCGAGTAAGGAAGGAGTATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032532.1-6045s1c1
Sequence:CCGGGCCTGGACAATGAACAGGATTCTCGAGAATCCTGTTCATTGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032532.1-942s1c1
Sequence:CCGGGCCCTAACAAAGCGAAAGATTCTCGAGAATCTTTCGCTTTGTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032532.1-5739s1c1
Sequence:CCGGCCTACTATTCAAGGCTACTATCTCGAGATAGTAGCCTTGAATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032532
FNDC1 MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032532.2-1976s21c1
Sequence:CCGGCCGAAGGGAAGGCGTAGATAACTCGAGTTATCTACGCCTTCCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032532.2-5538s21c1
Sequence:CCGGGACTGCCATGGACGGCAATATCTCGAGATATTGCCGTCCATGGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032532.1-4316s1c1
Sequence:CCGGCCTCCAAGATTCACATGGAAACTCGAGTTTCCATGTGAATCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032532.1-472s1c1
Sequence:CCGGCGGAGACATACTCCTTCCTTACTCGAGTAAGGAAGGAGTATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032532.1-6045s1c1
Sequence:CCGGGCCTGGACAATGAACAGGATTCTCGAGAATCCTGTTCATTGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032532.1-942s1c1
Sequence:CCGGGCCCTAACAAAGCGAAAGATTCTCGAGAATCTTTCGCTTTGTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032532.1-5739s1c1
Sequence:CCGGCCTACTATTCAAGGCTACTATCTCGAGATAGTAGCCTTGAATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032532
FNDC1 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032532.2-1976s21c1
Sequence:CCGGCCGAAGGGAAGGCGTAGATAACTCGAGTTATCTACGCCTTCCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032532.2-5538s21c1
Sequence:CCGGGACTGCCATGGACGGCAATATCTCGAGATATTGCCGTCCATGGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032532.1-4316s1c1
Sequence:CCGGCCTCCAAGATTCACATGGAAACTCGAGTTTCCATGTGAATCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032532.1-472s1c1
Sequence:CCGGCGGAGACATACTCCTTCCTTACTCGAGTAAGGAAGGAGTATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032532.1-6045s1c1
Sequence:CCGGGCCTGGACAATGAACAGGATTCTCGAGAATCCTGTTCATTGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032532.1-942s1c1
Sequence:CCGGGCCCTAACAAAGCGAAAGATTCTCGAGAATCTTTCGCTTTGTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032532.1-5739s1c1
Sequence:CCGGCCTACTATTCAAGGCTACTATCTCGAGATAGTAGCCTTGAATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081416
FNDC1 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081416.1-5038s21c1
Sequence:CCGGAGAACAGGGCCTCAATCTTATCTCGAGATAAGATTGAGGCCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081416.1-5072s21c1
Sequence:CCGGCCAACATTCAAGGCTACTATCCTCGAGGATAGTAGCCTTGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081416.1-4915s21c1
Sequence:CCGGTGTAATTCTCTAAGGTATAAGCTCGAGCTTATACCTTAGAGAATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081416.1-4853s21c1
Sequence:CCGGATTGCCATGGTCGGCAGTATGCTCGAGCATACTGCCGACCATGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081416.1-5367s21c1
Sequence:CCGGTTTCTTGGTCTGAACTATAAACTCGAGTTTATAGTTCAGACCAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081416
FNDC1 MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081416.1-5038s21c1
Sequence:CCGGAGAACAGGGCCTCAATCTTATCTCGAGATAAGATTGAGGCCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081416.1-5072s21c1
Sequence:CCGGCCAACATTCAAGGCTACTATCCTCGAGGATAGTAGCCTTGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081416.1-4915s21c1
Sequence:CCGGTGTAATTCTCTAAGGTATAAGCTCGAGCTTATACCTTAGAGAATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081416.1-4853s21c1
Sequence:CCGGATTGCCATGGTCGGCAGTATGCTCGAGCATACTGCCGACCATGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081416.1-5367s21c1
Sequence:CCGGTTTCTTGGTCTGAACTATAAACTCGAGTTTATAGTTCAGACCAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081416
FNDC1 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081416.1-5038s21c1
Sequence:CCGGAGAACAGGGCCTCAATCTTATCTCGAGATAAGATTGAGGCCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081416.1-5072s21c1
Sequence:CCGGCCAACATTCAAGGCTACTATCCTCGAGGATAGTAGCCTTGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081416.1-4915s21c1
Sequence:CCGGTGTAATTCTCTAAGGTATAAGCTCGAGCTTATACCTTAGAGAATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081416.1-4853s21c1
Sequence:CCGGATTGCCATGGTCGGCAGTATGCTCGAGCATACTGCCGACCATGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081416.1-5367s21c1
Sequence:CCGGTTTCTTGGTCTGAACTATAAACTCGAGTTTATAGTTCAGACCAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks