EMAIL THIS PAGE TO A FRIEND

FNDC3A

fibronectin type III domain containing 3A

225 Gene Product Result for
Synonyms: FNDC3 HUGO bA203I16.1 bA203I16.5
Gene ID:
Mouse(319448) fibronectin type III domain containing 3A
Rat(306022) fibronectin type III domain containing 3a
Zebrafish(335075) fibronectin type III domain containing 3A
cow(508840) fibronectin type III domain containing 3A
Horse(100056681) fibronectin type III domain containing 3A
domestic cat(101100857) fibronectin type III domain containing 3A
dog(476914) fibronectin type III domain containing 3A
chicken(418863) fibronectin type III domain containing 3A
sheep(101115134) fibronectin type III domain containing 3A
naked mole-rat(101699790) fibronectin type III domain containing 3A
domestic guinea pig(100719169) fibronectin type III domain containing 3A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_127837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014923 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079673 Rosetta Predictions human pricing
NM_014923 Rosetta Predictions human pricing
NM_001107278 Rosetta Predictions rat pricing
XM_224350 Rosetta Predictions rat pricing
NM_207636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313650 predicted 2613
2 SASI_Hs02_00313651 predicted 1736
3 SASI_Hs02_00313652 predicted 2179
4 SASI_Hs02_00313653 predicted 3650
5 SASI_Hs02_00313654 predicted 2704
6 SASI_Hs02_00313655 predicted 3114
7 SASI_Hs02_00313656 predicted 971
8 SASI_Hs02_00313657 predicted 3074
9 SASI_Hs02_00313658 predicted 1484
10 SASI_Hs02_00313659 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224975 predicted 2232
2 SASI_Hs01_00224976 predicted 1347
3 SASI_Hs01_00224977 predicted 1797
4 SASI_Hs01_00224979 predicted 3266
5 SASI_Hs01_00224980 predicted 2316
6 SASI_Hs02_00346570 predicted 2725
7 SASI_Hs01_00224981 predicted 580
8 SASI_Hs02_00346571 predicted 2690
9 SASI_Hs01_00224982 predicted 1095
10 SASI_Hs01_00224983 predicted 791
11 SASI_Hs01_00224978 predicted 2113
12 SASI_Hs01_00224984 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227265 predicted 1798
2 SASI_Rn02_00227266 predicted 2468
3 SASI_Rn02_00227267 predicted 3291
4 SASI_Rn02_00227268 predicted 2380
5 SASI_Rn02_00227269 predicted 2528
6 SASI_Rn02_00227270 predicted 1716
7 SASI_Rn02_00227271 predicted 2147
8 SASI_Rn02_00227272 predicted 1436
9 SASI_Rn02_00227273 predicted 1988
10 SASI_Rn02_00227274 predicted 2715
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180930 predicted 1971
2 SASI_Rn01_00180931 predicted 2663
3 SASI_Rn01_00180932 predicted 3489
4 SASI_Rn01_00180933 predicted 1231
5 SASI_Rn01_00180934 predicted 892
6 SASI_Rn01_00180935 predicted 2730
7 SASI_Rn01_00180936 predicted 3033
8 SASI_Rn01_00180937 predicted 1894
9 SASI_Rn01_00180938 predicted 1603
10 SASI_Rn01_00180939 predicted 2157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352158 predicted 779
2 SASI_Mm01_00177745 predicted 2633
3 SASI_Mm02_00352159 predicted 2969
4 SASI_Mm02_00352160 predicted 3091
5 SASI_Mm01_00177746 predicted 1949
6 SASI_Mm01_00177748 predicted 2402
7 SASI_Mm01_00177749 predicted 766
8 SASI_Mm01_00177750 predicted 1659
9 SASI_Mm01_00177751 predicted 3377
10 SASI_Mm01_00177752 predicted 3009
11 SASI_Mm01_00177744 predicted 955
12 SASI_Mm01_00177747 predicted 2785
13 SASI_Mm01_00177753 predicted 850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127837
VALIDATED
FNDC3A MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 3A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127837.2-4960s1c1
Sequence:CCGGGCCGTCAGAATTTCTAATCAACTCGAGTTGATTAGAAATTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127837.2-1407s1c1
Sequence:CCGGCGGAAAGCTTTACGACCTTAACTCGAGTTAAGGTCGTAAAGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127837.2-2033s1c1
Sequence:CCGGCCTTCAGTTAAAGGGAAGATACTCGAGTATCTTCCCTTTAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127837.2-2882s1c1
Sequence:CCGGCCTGCCATTGTGACTTGTCTTCTCGAGAAGACAAGTCACAATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127837.2-571s1c1
Sequence:CCGGCCCACAGGTTATCGAAGACAACTCGAGTTGTCTTCGATAACCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127837
VALIDATED
FNDC3A MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 3A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127837.2-4960s1c1
Sequence:CCGGGCCGTCAGAATTTCTAATCAACTCGAGTTGATTAGAAATTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127837.2-1407s1c1
Sequence:CCGGCGGAAAGCTTTACGACCTTAACTCGAGTTAAGGTCGTAAAGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127837.2-2033s1c1
Sequence:CCGGCCTTCAGTTAAAGGGAAGATACTCGAGTATCTTCCCTTTAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127837.2-2882s1c1
Sequence:CCGGCCTGCCATTGTGACTTGTCTTCTCGAGAAGACAAGTCACAATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127837.2-571s1c1
Sequence:CCGGCCCACAGGTTATCGAAGACAACTCGAGTTGTCTTCGATAACCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127837
VALIDATED
FNDC3A MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 3A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127837.2-4960s1c1
Sequence:CCGGGCCGTCAGAATTTCTAATCAACTCGAGTTGATTAGAAATTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127837.2-1407s1c1
Sequence:CCGGCGGAAAGCTTTACGACCTTAACTCGAGTTAAGGTCGTAAAGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127837.2-2033s1c1
Sequence:CCGGCCTTCAGTTAAAGGGAAGATACTCGAGTATCTTCCCTTTAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127837.2-2882s1c1
Sequence:CCGGCCTGCCATTGTGACTTGTCTTCTCGAGAAGACAAGTCACAATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127837.2-571s1c1
Sequence:CCGGCCCACAGGTTATCGAAGACAACTCGAGTTGTCTTCGATAACCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014923
VALIDATED
FNDC3A MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 3A
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-3074s1c1
Sequence:CCGGCGTCTGGAATGTGTTGCCTTTCTCGAGAAAGGCAACACATTCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-3134s1c1
Sequence:CCGGCCAAAGACATTGTCAACCGATCTCGAGATCGGTTGACAATGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014923.2-1388s1c1
Sequence:CCGGCCTAGTGACAATGGTTCTAAACTCGAGTTTAGAACCATTGTCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014923.2-3434s1c1
Sequence:CCGGGATCCAGTTATTTACAGTCTTCTCGAGAAGACTGTAAATAACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-1128s1c1
Sequence:CCGGGTTATGAAGTTCTGATCTCAACTCGAGTTGAGATCAGAACTTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014923.2-455s1c1
Sequence:CCGGCCACAGGTTATTGAAGACAATCTCGAGATTGTCTTCAATAACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014923.2-4948s1c1
Sequence:CCGGGCATGTGGTTAATGTTGCATTCTCGAGAATGCAACATTAACCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014923.2-5422s1c1
Sequence:CCGGGCCTTTCTAAGTGGTAAGAATCTCGAGATTCTTACCACTTAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-3437s1c1
Sequence:CCGGCCAGTTATTTACAGTCTTCAACTCGAGTTGAAGACTGTAAATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-2635s1c1
Sequence:CCGGGCCTGGTCTCAGTTATGAAATCTCGAGATTTCATAACTGAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160817    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014923.2-4862s1c1
Sequence:CCGGCCAGTAAACTTCAAGCTGCTTCTCGAGAAGCAGCTTGAAGTTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014923.3-2845s21c1
Sequence:CCGGCCAAAGACATTGTCAACCGATCTCGAGATCGGTTGACAATGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014923.3-2377s21c1
Sequence:CCGGTCACCAGCAACTACCTATTATCTCGAGATAATAGGTAGTTGCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014923.3-2960s21c1
Sequence:CCGGATGAGTCAACATCCTATAAATCTCGAGATTTATAGGATGTTGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014923.3-3620s21c1
Sequence:CCGGTGAGACTATAGCACATCATTTCTCGAGAAATGATGTGCTATAGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014923.3-839s21c1
Sequence:CCGGGTTATGAAGTTCTGATCTCAACTCGAGTTGAGATCAGAACTTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014923
VALIDATED
FNDC3A MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 3A
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-3074s1c1
Sequence:CCGGCGTCTGGAATGTGTTGCCTTTCTCGAGAAAGGCAACACATTCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-3134s1c1
Sequence:CCGGCCAAAGACATTGTCAACCGATCTCGAGATCGGTTGACAATGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014923.2-1388s1c1
Sequence:CCGGCCTAGTGACAATGGTTCTAAACTCGAGTTTAGAACCATTGTCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014923.2-3434s1c1
Sequence:CCGGGATCCAGTTATTTACAGTCTTCTCGAGAAGACTGTAAATAACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-1128s1c1
Sequence:CCGGGTTATGAAGTTCTGATCTCAACTCGAGTTGAGATCAGAACTTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014923.2-455s1c1
Sequence:CCGGCCACAGGTTATTGAAGACAATCTCGAGATTGTCTTCAATAACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014923.2-4948s1c1
Sequence:CCGGGCATGTGGTTAATGTTGCATTCTCGAGAATGCAACATTAACCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014923.2-5422s1c1
Sequence:CCGGGCCTTTCTAAGTGGTAAGAATCTCGAGATTCTTACCACTTAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-3437s1c1
Sequence:CCGGCCAGTTATTTACAGTCTTCAACTCGAGTTGAAGACTGTAAATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-2635s1c1
Sequence:CCGGGCCTGGTCTCAGTTATGAAATCTCGAGATTTCATAACTGAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160817    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014923.2-4862s1c1
Sequence:CCGGCCAGTAAACTTCAAGCTGCTTCTCGAGAAGCAGCTTGAAGTTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014923.3-2845s21c1
Sequence:CCGGCCAAAGACATTGTCAACCGATCTCGAGATCGGTTGACAATGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014923.3-2377s21c1
Sequence:CCGGTCACCAGCAACTACCTATTATCTCGAGATAATAGGTAGTTGCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014923.3-2960s21c1
Sequence:CCGGATGAGTCAACATCCTATAAATCTCGAGATTTATAGGATGTTGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014923.3-3620s21c1
Sequence:CCGGTGAGACTATAGCACATCATTTCTCGAGAAATGATGTGCTATAGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014923.3-839s21c1
Sequence:CCGGGTTATGAAGTTCTGATCTCAACTCGAGTTGAGATCAGAACTTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014923
VALIDATED
FNDC3A MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 3A
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-3074s1c1
Sequence:CCGGCGTCTGGAATGTGTTGCCTTTCTCGAGAAAGGCAACACATTCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-3134s1c1
Sequence:CCGGCCAAAGACATTGTCAACCGATCTCGAGATCGGTTGACAATGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014923.2-1388s1c1
Sequence:CCGGCCTAGTGACAATGGTTCTAAACTCGAGTTTAGAACCATTGTCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014923.2-3434s1c1
Sequence:CCGGGATCCAGTTATTTACAGTCTTCTCGAGAAGACTGTAAATAACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-1128s1c1
Sequence:CCGGGTTATGAAGTTCTGATCTCAACTCGAGTTGAGATCAGAACTTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014923.2-455s1c1
Sequence:CCGGCCACAGGTTATTGAAGACAATCTCGAGATTGTCTTCAATAACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014923.2-4948s1c1
Sequence:CCGGGCATGTGGTTAATGTTGCATTCTCGAGAATGCAACATTAACCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014923.2-5422s1c1
Sequence:CCGGGCCTTTCTAAGTGGTAAGAATCTCGAGATTCTTACCACTTAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-3437s1c1
Sequence:CCGGCCAGTTATTTACAGTCTTCAACTCGAGTTGAAGACTGTAAATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014923.2-2635s1c1
Sequence:CCGGGCCTGGTCTCAGTTATGAAATCTCGAGATTTCATAACTGAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160817    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014923.2-4862s1c1
Sequence:CCGGCCAGTAAACTTCAAGCTGCTTCTCGAGAAGCAGCTTGAAGTTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014923.3-2845s21c1
Sequence:CCGGCCAAAGACATTGTCAACCGATCTCGAGATCGGTTGACAATGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014923.3-2377s21c1
Sequence:CCGGTCACCAGCAACTACCTATTATCTCGAGATAATAGGTAGTTGCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014923.3-2960s21c1
Sequence:CCGGATGAGTCAACATCCTATAAATCTCGAGATTTATAGGATGTTGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014923.3-3620s21c1
Sequence:CCGGTGAGACTATAGCACATCATTTCTCGAGAAATGATGTGCTATAGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014923.3-839s21c1
Sequence:CCGGGTTATGAAGTTCTGATCTCAACTCGAGTTGAGATCAGAACTTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207636
FNDC3A MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 3A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000339998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207636.2-2033s21c1
Sequence:CCGGCCTTCAGTTAAAGGGAAGATACTCGAGTATCTTCCCTTTAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207636.2-571s21c1
Sequence:CCGGCCCACAGGTTATCGAAGACAACTCGAGTTGTCTTCGATAACCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207636.2-756s21c1
Sequence:CCGGGCGACATGGCAACGCAGTATACTCGAGTATACTGCGTTGCCATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207636.2-1407s21c1
Sequence:CCGGCGGAAAGCTTTACGACCTTAACTCGAGTTAAGGTCGTAAAGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207636
FNDC3A MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 3A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000339998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207636.2-2033s21c1
Sequence:CCGGCCTTCAGTTAAAGGGAAGATACTCGAGTATCTTCCCTTTAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207636.2-571s21c1
Sequence:CCGGCCCACAGGTTATCGAAGACAACTCGAGTTGTCTTCGATAACCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207636.2-756s21c1
Sequence:CCGGGCGACATGGCAACGCAGTATACTCGAGTATACTGCGTTGCCATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207636.2-1407s21c1
Sequence:CCGGCGGAAAGCTTTACGACCTTAACTCGAGTTAAGGTCGTAAAGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207636
FNDC3A MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 3A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000339998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207636.2-2033s21c1
Sequence:CCGGCCTTCAGTTAAAGGGAAGATACTCGAGTATCTTCCCTTTAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207636.2-571s21c1
Sequence:CCGGCCCACAGGTTATCGAAGACAACTCGAGTTGTCTTCGATAACCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207636.2-756s21c1
Sequence:CCGGGCGACATGGCAACGCAGTATACTCGAGTATACTGCGTTGCCATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207636.2-1407s21c1
Sequence:CCGGCGGAAAGCTTTACGACCTTAACTCGAGTTAAGGTCGTAAAGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks