EMAIL THIS PAGE TO A FRIEND

FNDC3B

fibronectin type III domain containing 3B

263 Gene Product Result for
Synonyms: FAD104 PRO4979 YVTM2421
Gene ID:
Mouse(72007) fibronectin type III domain containing 3B
Rat(294925) fibronectin type III domain containing 3B
domestic guinea pig(100731163) fibronectin type III domain containing 3B
naked mole-rat(101701030) fibronectin type III domain containing 3B
sheep(101114406) fibronectin type III domain containing 3B
Domestic Rabbit(100355308) fibronectin type III domain containing 3B
chicken(424984) fibronectin type III domain containing 3B
dog(488169) fibronectin type III domain containing 3B
Horse(100057824) fibronectin type III domain containing 3B
cow(615534) fibronectin type III domain containing 3B
domestic cat(101083793) fibronectin type III domain containing 3B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA007859 Anti-FNDC3B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
AV49753 Anti-FNDC3B antibody produced in rabbit IgG fraction of antiserum guinea pig, human, rabbit, rat, horse, mouse, canine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022763 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091281 MISSION® esiRNA esiRNA human FNDC3B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022763 Rosetta Predictions human pricing
XM_001057133 Rosetta Predictions rat pricing
XM_226988 Rosetta Predictions rat pricing
NM_173182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356032 predicted 3369
2 SASI_Hs02_00356033 predicted 1254
3 SASI_Hs02_00356034 predicted 3239
4 SASI_Hs01_00057095 predicted 2130
5 SASI_Hs02_00356035 predicted 1862
6 SASI_Hs01_00057097 predicted 864
7 SASI_Hs01_00057098 predicted 1678
8 SASI_Hs01_00057099 predicted 3224
9 SASI_Hs01_00057101 predicted 3409
10 SASI_Hs02_00356036 predicted 673
11 SASI_Hs01_00057093 predicted 832
12 SASI_Hs01_00057094 predicted 504
13 SASI_Hs01_00057096 predicted 1092
14 SASI_Hs01_00057100 predicted 1809
15 SASI_Hs01_00057102 predicted 2039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285541 predicted 1093
2 SASI_Rn02_00285542 predicted 2829
3 SASI_Rn02_00285543 predicted 819
4 SASI_Rn02_00285544 predicted 1711
5 SASI_Rn02_00285545 predicted 1043
6 SASI_Rn02_00285546 predicted 2779
7 SASI_Rn02_00285547 predicted 2081
8 SASI_Rn02_00285548 predicted 3325
9 SASI_Rn02_00285549 predicted 973
10 SASI_Rn02_00285550 predicted 2031
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384011 predicted 1095
2 SASI_Rn02_00384012 predicted 2837
3 SASI_Rn02_00384013 predicted 817
4 SASI_Rn02_00384014 predicted 1713
5 SASI_Rn02_00384015 predicted 1039
6 SASI_Rn02_00384016 predicted 2773
7 SASI_Rn02_00384017 predicted 2083
8 SASI_Rn02_00384018 predicted 3324
9 SASI_Rn02_00384019 predicted 979
10 SASI_Rn02_00384020 predicted 2025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122042 predicted 3569
2 SASI_Mm01_00122044 predicted 1169
3 SASI_Mm02_00345151 predicted 977
4 SASI_Mm01_00122047 predicted 2989
5 SASI_Mm01_00122048 predicted 2664
6 SASI_Mm01_00122049 predicted 2821
7 SASI_Mm02_00345152 predicted 361
8 SASI_Mm01_00122046 predicted 780
9 SASI_Mm01_00122050 predicted 2124
10 SASI_Mm01_00122051 predicted 1330
11 SASI_Mm01_00122043 predicted 3360
12 SASI_Mm01_00122045 predicted 2118
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173182
VALIDATED
FNDC3B MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 3B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173182.2-3816s21c1
Sequence:CCGGTTTACGCTGTTTCGTTCTTTGCTCGAGCAAAGAACGAAACAGCGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173182.2-2556s21c1
Sequence:CCGGCAGTCCTTAGAACTCGTTTATCTCGAGATAAACGAGTTCTAAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173182.2-1747s21c1
Sequence:CCGGAGCGAAGCACACAGTATAAATCTCGAGATTTATACTGTGTGCTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173182.1-6085s1c1
Sequence:CCGGCGCCATTATTTGCTATTCATTCTCGAGAATGAATAGCAAATAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173182.1-2746s1c1
Sequence:CCGGCCGTGCAATAATGGGTCTGAACTCGAGTTCAGACCCATTATTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173182.1-1115s1c1
Sequence:CCGGCGGATTACCATGTGAGGGTATCTCGAGATACCCTCACATGGTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173182.1-1973s1c1
Sequence:CCGGCCCATTTGAAACCAGGCACTTCTCGAGAAGTGCCTGGTTTCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173182.1-2747s1c1
Sequence:CCGGCGTGCAATAATGGGTCTGAAACTCGAGTTTCAGACCCATTATTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173182
VALIDATED
FNDC3B MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 3B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173182.2-3816s21c1
Sequence:CCGGTTTACGCTGTTTCGTTCTTTGCTCGAGCAAAGAACGAAACAGCGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173182.2-2556s21c1
Sequence:CCGGCAGTCCTTAGAACTCGTTTATCTCGAGATAAACGAGTTCTAAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173182.2-1747s21c1
Sequence:CCGGAGCGAAGCACACAGTATAAATCTCGAGATTTATACTGTGTGCTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173182.1-6085s1c1
Sequence:CCGGCGCCATTATTTGCTATTCATTCTCGAGAATGAATAGCAAATAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173182.1-2746s1c1
Sequence:CCGGCCGTGCAATAATGGGTCTGAACTCGAGTTCAGACCCATTATTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173182.1-1115s1c1
Sequence:CCGGCGGATTACCATGTGAGGGTATCTCGAGATACCCTCACATGGTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173182.1-1973s1c1
Sequence:CCGGCCCATTTGAAACCAGGCACTTCTCGAGAAGTGCCTGGTTTCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173182.1-2747s1c1
Sequence:CCGGCGTGCAATAATGGGTCTGAAACTCGAGTTTCAGACCCATTATTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173182
VALIDATED
FNDC3B MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 3B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173182.2-3816s21c1
Sequence:CCGGTTTACGCTGTTTCGTTCTTTGCTCGAGCAAAGAACGAAACAGCGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173182.2-2556s21c1
Sequence:CCGGCAGTCCTTAGAACTCGTTTATCTCGAGATAAACGAGTTCTAAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173182.2-1747s21c1
Sequence:CCGGAGCGAAGCACACAGTATAAATCTCGAGATTTATACTGTGTGCTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173182.1-6085s1c1
Sequence:CCGGCGCCATTATTTGCTATTCATTCTCGAGAATGAATAGCAAATAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173182.1-2746s1c1
Sequence:CCGGCCGTGCAATAATGGGTCTGAACTCGAGTTCAGACCCATTATTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173182.1-1115s1c1
Sequence:CCGGCGGATTACCATGTGAGGGTATCTCGAGATACCCTCACATGGTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173182.1-1973s1c1
Sequence:CCGGCCCATTTGAAACCAGGCACTTCTCGAGAAGTGCCTGGTTTCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173182.1-2747s1c1
Sequence:CCGGCGTGCAATAATGGGTCTGAAACTCGAGTTTCAGACCCATTATTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022763
VALIDATED
FNDC3B MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 3B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-5029s21c1
Sequence:GTACCGGGTGTTACTCTTACGTGTTTATCTCGAGATAAACACGTAAGAGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-3051s21c1
Sequence:CCGGGGACAGAAACAAGAGGTTTATCTCGAGATAAACCTCTTGTTTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-771s21c1
Sequence:CCGGCGGTAGTGGTCCCGGAATTAACTCGAGTTAATTCCGGGACCACTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-295s21c1
Sequence:CCGGCATGTGCCTCCAGGTTATATCCTCGAGGATATAACCTGGAGGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-155s21c1
Sequence:CCGGATGCAGCTCAGCAGGTTATTCCTCGAGGAATAACCTGCTGAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022763.3-1240s21c1
Sequence:GTACCGGTGCCATGTACAATTCCGTAAACTCGAGTTTACGGAATTGTACATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022763.2-6603s1c1
Sequence:CCGGCCCTAATTGAATGTGTTTGAACTCGAGTTCAAACACATTCAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022763.2-2735s1c1
Sequence:CCGGCGTGCAATAACGGATCTGAAACTCGAGTTTCAGATCCGTTATTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022763.2-815s1c1
Sequence:CCGGGCAGCCCAAAGTCGAATGATTCTCGAGAATCATTCGACTTTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022763.2-3598s1c1
Sequence:CCGGGCCATCATTGTGCTTGGCTTTCTCGAGAAAGCCAAGCACAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_022763.2-2745s1c1
Sequence:CCGGCGGATCTGAAATCCTTGCTTACTCGAGTAAGCAAGGATTTCAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022763
VALIDATED
FNDC3B MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 3B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-5029s21c1
Sequence:GTACCGGGTGTTACTCTTACGTGTTTATCTCGAGATAAACACGTAAGAGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-3051s21c1
Sequence:CCGGGGACAGAAACAAGAGGTTTATCTCGAGATAAACCTCTTGTTTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-771s21c1
Sequence:CCGGCGGTAGTGGTCCCGGAATTAACTCGAGTTAATTCCGGGACCACTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-295s21c1
Sequence:CCGGCATGTGCCTCCAGGTTATATCCTCGAGGATATAACCTGGAGGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-155s21c1
Sequence:CCGGATGCAGCTCAGCAGGTTATTCCTCGAGGAATAACCTGCTGAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022763.3-1240s21c1
Sequence:GTACCGGTGCCATGTACAATTCCGTAAACTCGAGTTTACGGAATTGTACATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022763.2-6603s1c1
Sequence:CCGGCCCTAATTGAATGTGTTTGAACTCGAGTTCAAACACATTCAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022763.2-2735s1c1
Sequence:CCGGCGTGCAATAACGGATCTGAAACTCGAGTTTCAGATCCGTTATTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022763.2-815s1c1
Sequence:CCGGGCAGCCCAAAGTCGAATGATTCTCGAGAATCATTCGACTTTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022763.2-3598s1c1
Sequence:CCGGGCCATCATTGTGCTTGGCTTTCTCGAGAAAGCCAAGCACAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_022763.2-2745s1c1
Sequence:CCGGCGGATCTGAAATCCTTGCTTACTCGAGTAAGCAAGGATTTCAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022763
VALIDATED
FNDC3B MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 3B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-5029s21c1
Sequence:GTACCGGGTGTTACTCTTACGTGTTTATCTCGAGATAAACACGTAAGAGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-3051s21c1
Sequence:CCGGGGACAGAAACAAGAGGTTTATCTCGAGATAAACCTCTTGTTTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-771s21c1
Sequence:CCGGCGGTAGTGGTCCCGGAATTAACTCGAGTTAATTCCGGGACCACTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-295s21c1
Sequence:CCGGCATGTGCCTCCAGGTTATATCCTCGAGGATATAACCTGGAGGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_022763.2-155s21c1
Sequence:CCGGATGCAGCTCAGCAGGTTATTCCTCGAGGAATAACCTGCTGAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022763.3-1240s21c1
Sequence:GTACCGGTGCCATGTACAATTCCGTAAACTCGAGTTTACGGAATTGTACATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022763.2-6603s1c1
Sequence:CCGGCCCTAATTGAATGTGTTTGAACTCGAGTTCAAACACATTCAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022763.2-2735s1c1
Sequence:CCGGCGTGCAATAACGGATCTGAAACTCGAGTTTCAGATCCGTTATTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022763.2-815s1c1
Sequence:CCGGGCAGCCCAAAGTCGAATGATTCTCGAGAATCATTCGACTTTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022763.2-3598s1c1
Sequence:CCGGGCCATCATTGTGCTTGGCTTTCTCGAGAAAGCCAAGCACAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_022763.2-2745s1c1
Sequence:CCGGCGGATCTGAAATCCTTGCTTACTCGAGTAAGCAAGGATTTCAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks