EMAIL THIS PAGE TO A FRIEND

FNDC4

fibronectin type III domain containing 4

Synonyms: FRCP1
UniProtKB ID: Q9H6D8, D6W560
Gene ID:
Mouse(64339) fibronectin type III domain containing 4
chicken(421981) fibronectin type III domain containing 4
dog(483014) fibronectin type III domain containing 4
domestic cat(101096226) fibronectin type III domain containing 4
cow(781806) fibronectin type III domain containing 4
domestic guinea pig(100713206) fibronectin type III domain containing 4
naked mole-rat(101718165) fibronectin type III domain containing 4
sheep(101118933) fibronectin type III domain containing 4
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022823 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022823 Rosetta Predictions human pricing
NM_022424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096094 predicted 628
2 SASI_Hs01_00096095 predicted 1086
3 SASI_Hs01_00096096 predicted 596
4 SASI_Hs01_00096097 predicted 1082
5 SASI_Hs01_00096098 predicted 1054
6 SASI_Hs01_00096099 predicted 1357
7 SASI_Hs01_00096100 predicted 1317
8 SASI_Hs01_00096101 predicted 1325
9 SASI_Hs01_00096102 predicted 1269
10 SASI_Hs01_00096103 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326595 predicted 1273
2 SASI_Mm01_00104911 predicted 619
3 SASI_Mm01_00104912 predicted 1047
4 SASI_Mm01_00104914 predicted 589
5 SASI_Mm01_00104915 predicted 1052
6 SASI_Mm01_00104916 predicted 1144
7 SASI_Mm01_00104917 predicted 1238
8 SASI_Mm02_00326596 predicted 1320
9 SASI_Mm01_00104918 predicted 910
10 SASI_Mm01_00104919 predicted 1231
11 SASI_Mm01_00104913 predicted 1373
12 SASI_Mm01_00104920 predicted 400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022823
FNDC4 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022823.1-1049s1c1
Sequence:CCGGCTATCAACACCATCGACGTTTCTCGAGAAACGTCGATGGTGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022823.1-963s1c1
Sequence:CCGGCAACAACAATCCCAAGGAGAACTCGAGTTCTCCTTGGGATTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022823.1-1273s1c1
Sequence:CCGGGAGTGGATATCAGATGGGATACTCGAGTATCCCATCTGATATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022823.1-1041s1c1
Sequence:CCGGGTCACCATCTATCAACACCATCTCGAGATGGTGTTGATAGATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022823.1-908s1c1
Sequence:CCGGCTGCTGTAATTGGGCTGTTCTCTCGAGAGAACAGCCCAATTACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022823.1-585s1c1
Sequence:CCGGCATCGTCATTGGCTACTCCATCTCGAGATGGAGTAGCCAATGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022823
FNDC4 MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022823.1-1049s1c1
Sequence:CCGGCTATCAACACCATCGACGTTTCTCGAGAAACGTCGATGGTGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022823.1-963s1c1
Sequence:CCGGCAACAACAATCCCAAGGAGAACTCGAGTTCTCCTTGGGATTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022823.1-1273s1c1
Sequence:CCGGGAGTGGATATCAGATGGGATACTCGAGTATCCCATCTGATATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022823.1-1041s1c1
Sequence:CCGGGTCACCATCTATCAACACCATCTCGAGATGGTGTTGATAGATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022823.1-908s1c1
Sequence:CCGGCTGCTGTAATTGGGCTGTTCTCTCGAGAGAACAGCCCAATTACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022823.1-585s1c1
Sequence:CCGGCATCGTCATTGGCTACTCCATCTCGAGATGGAGTAGCCAATGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022823
FNDC4 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022823.1-1049s1c1
Sequence:CCGGCTATCAACACCATCGACGTTTCTCGAGAAACGTCGATGGTGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022823.1-963s1c1
Sequence:CCGGCAACAACAATCCCAAGGAGAACTCGAGTTCTCCTTGGGATTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022823.1-1273s1c1
Sequence:CCGGGAGTGGATATCAGATGGGATACTCGAGTATCCCATCTGATATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022823.1-1041s1c1
Sequence:CCGGGTCACCATCTATCAACACCATCTCGAGATGGTGTTGATAGATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022823.1-908s1c1
Sequence:CCGGCTGCTGTAATTGGGCTGTTCTCTCGAGAGAACAGCCCAATTACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022823.1-585s1c1
Sequence:CCGGCATCGTCATTGGCTACTCCATCTCGAGATGGAGTAGCCAATGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022424
VALIDATED
FNDC4 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022424.2-218s1c1
Sequence:CCGGGATCGGATGAAGAACCAGAACCTCGAGGTTCTGGTTCTTCATCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022424.2-1086s1c1
Sequence:CCGGCCTTGTGCATACTAAGCAAATCTCGAGATTTGCTTAGTATGCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022424.2-889s1c1
Sequence:CCGGGCGTCAGTGTAACAATGTATTCTCGAGAATACATTGTTACACTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022424.2-259s1c1
Sequence:CCGGGAGGATGCACTGTATGAGTAACTCGAGTTACTCATACAGTGCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022424.2-211s1c1
Sequence:CCGGGATGTTTGATCGGATGAAGAACTCGAGTTCTTCATCCGATCAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022424.2-193s1c1
Sequence:CCGGCCATCAATCAACACCATTGATCTCGAGATCAATGGTGTTGATTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022424.5-1039s21c1
Sequence:CCGGCCATCAATCAACACCATTGATCTCGAGATCAATGGTGTTGATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022424.5-1106s21c1
Sequence:CCGGAGGATGCACTGTATGAGTAAGCTCGAGCTTACTCATACAGTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022424.5-911s21c1
Sequence:CCGGGGCTATTCTGCCGTCAGTATGCTCGAGCATACTGACGGCAGAATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022424.5-1064s21c1
Sequence:CCGGGATCGGATGAAGAACCAGAACCTCGAGGTTCTGGTTCTTCATCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022424.5-867s1c1
Sequence:CCGGCGTCATCATTGTAGTGGTATTCTCGAGAATACCACTACAATGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022424.5-800s21c1
Sequence:CCGGGCTCCAGTCCAGGTGATATTACTCGAGTAATATCACCTGGACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022424
VALIDATED
FNDC4 MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022424.2-218s1c1
Sequence:CCGGGATCGGATGAAGAACCAGAACCTCGAGGTTCTGGTTCTTCATCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022424.2-1086s1c1
Sequence:CCGGCCTTGTGCATACTAAGCAAATCTCGAGATTTGCTTAGTATGCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022424.2-889s1c1
Sequence:CCGGGCGTCAGTGTAACAATGTATTCTCGAGAATACATTGTTACACTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022424.2-259s1c1
Sequence:CCGGGAGGATGCACTGTATGAGTAACTCGAGTTACTCATACAGTGCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022424.2-211s1c1
Sequence:CCGGGATGTTTGATCGGATGAAGAACTCGAGTTCTTCATCCGATCAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022424.2-193s1c1
Sequence:CCGGCCATCAATCAACACCATTGATCTCGAGATCAATGGTGTTGATTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022424.5-1039s21c1
Sequence:CCGGCCATCAATCAACACCATTGATCTCGAGATCAATGGTGTTGATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022424.5-1106s21c1
Sequence:CCGGAGGATGCACTGTATGAGTAAGCTCGAGCTTACTCATACAGTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022424.5-911s21c1
Sequence:CCGGGGCTATTCTGCCGTCAGTATGCTCGAGCATACTGACGGCAGAATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022424.5-1064s21c1
Sequence:CCGGGATCGGATGAAGAACCAGAACCTCGAGGTTCTGGTTCTTCATCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022424.5-867s1c1
Sequence:CCGGCGTCATCATTGTAGTGGTATTCTCGAGAATACCACTACAATGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022424.5-800s21c1
Sequence:CCGGGCTCCAGTCCAGGTGATATTACTCGAGTAATATCACCTGGACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022424
VALIDATED
FNDC4 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022424.2-218s1c1
Sequence:CCGGGATCGGATGAAGAACCAGAACCTCGAGGTTCTGGTTCTTCATCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022424.2-1086s1c1
Sequence:CCGGCCTTGTGCATACTAAGCAAATCTCGAGATTTGCTTAGTATGCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022424.2-889s1c1
Sequence:CCGGGCGTCAGTGTAACAATGTATTCTCGAGAATACATTGTTACACTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022424.2-259s1c1
Sequence:CCGGGAGGATGCACTGTATGAGTAACTCGAGTTACTCATACAGTGCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022424.2-211s1c1
Sequence:CCGGGATGTTTGATCGGATGAAGAACTCGAGTTCTTCATCCGATCAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022424.2-193s1c1
Sequence:CCGGCCATCAATCAACACCATTGATCTCGAGATCAATGGTGTTGATTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022424.5-1039s21c1
Sequence:CCGGCCATCAATCAACACCATTGATCTCGAGATCAATGGTGTTGATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022424.5-1106s21c1
Sequence:CCGGAGGATGCACTGTATGAGTAAGCTCGAGCTTACTCATACAGTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022424.5-911s21c1
Sequence:CCGGGGCTATTCTGCCGTCAGTATGCTCGAGCATACTGACGGCAGAATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022424.5-1064s21c1
Sequence:CCGGGATCGGATGAAGAACCAGAACCTCGAGGTTCTGGTTCTTCATCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022424.5-867s1c1
Sequence:CCGGCGTCATCATTGTAGTGGTATTCTCGAGAATACCACTACAATGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022424.5-800s21c1
Sequence:CCGGGCTCCAGTCCAGGTGATATTACTCGAGTAATATCACCTGGACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks