EMAIL THIS PAGE TO A FRIEND

FNDC5

fibronectin type III domain containing 5

207 Gene Product Result for
Synonyms: FRCP2 irisin
UniProtKB ID: Q8NAU1, A6NMC9, D3DPQ6, Q6P6D9, Q7Z676
Gene ID:
Human(252995) Summary: This gene encodes a secreted protein that is released from muscle cells during exercise. The encoded protein may participate in the development of brown fat. Translation of the precursor protein initiates at a non-AUG start codon at a position that is conserved as an AUG start codon in other organisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Mouse(384061) fibronectin type III domain containing 5
Rat(260327) fibronectin type III domain containing 5
chicken(419667) fibronectin type III domain containing 5
dog(487302) fibronectin type III domain containing 5
cow(538905) fibronectin type III domain containing 5
domestic cat(101083019) fibronectin type III domain containing 5
sheep(101104971) fibronectin type III domain containing 5
naked mole-rat(101725280) fibronectin type III domain containing 5
domestic guinea pig(100726842) fibronectin type III domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153756 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153756 Rosetta Predictions human pricing
XM_001060505 Rosetta Predictions rat pricing
XM_342924 Rosetta Predictions rat pricing
NM_027402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197269 predicted 1019
2 SASI_Hs01_00197270 predicted 950
3 SASI_Hs01_00197271 predicted 500
4 SASI_Hs02_00367465 predicted 655
5 SASI_Hs01_00197274 predicted 762
6 SASI_Hs01_00197275 predicted 810
7 SASI_Hs02_00367466 predicted 608
8 SASI_Hs01_00197276 predicted 777
9 SASI_Hs01_00197277 predicted 734
10 SASI_Hs02_00367467 predicted 671
11 SASI_Hs01_00197268 predicted 804
12 SASI_Hs01_00197272 predicted 959
13 SASI_Hs01_00197273 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296732 predicted 470
2 SASI_Rn02_00296733 predicted 432
3 SASI_Rn02_00296734 predicted 322
4 SASI_Rn02_00296735 predicted 268
5 SASI_Rn02_00296736 predicted 356
6 SASI_Rn02_00296737 predicted 257
7 SASI_Rn02_00296738 predicted 433
8 SASI_Rn02_00296739 predicted 326
9 SASI_Rn02_00296740 predicted 462
10 SASI_Rn02_00296741 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175267 predicted 216
2 SASI_Rn01_00175268 predicted 220
3 SASI_Rn01_00175269 predicted 282
4 SASI_Rn01_00175270 predicted 381
5 SASI_Rn01_00175271 predicted 374
6 SASI_Rn01_00175272 predicted 542
7 SASI_Rn01_00175273 predicted 495
8 SASI_Rn01_00175274 predicted 474
9 SASI_Rn01_00175275 predicted 216
10 SASI_Rn01_00175276 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166164 predicted 770
2 SASI_Mm01_00166165 predicted 775
3 SASI_Mm01_00166166 predicted 326
4 SASI_Mm02_00332125 predicted 773
5 SASI_Mm01_00166167 predicted 1132
6 SASI_Mm01_00166168 predicted 1037
7 SASI_Mm02_00332126 predicted 772
8 SASI_Mm01_00166169 predicted 714
9 SASI_Mm01_00166171 predicted 820
10 SASI_Mm01_00166172 predicted 487
11 SASI_Mm01_00166170 predicted 632
12 SASI_Mm01_00166173 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027402
FNDC5 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027402.2-1217s1c1
Sequence:CCGGCCCTCTGTGAACATCATCAAACTCGAGTTTGATGATGTTCACAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027402.2-302s1c1
Sequence:CCGGGACACAGAATATATCGTCCATCTCGAGATGGACGATATATTCTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027402.2-230s1c1
Sequence:CCGGGTGCGGATGCTCCGGTTCATTCTCGAGAATGAACCGGAGCATCCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027402.2-518s1c1
Sequence:CCGGGCTCTCTTCTGCCGCCAGTATCTCGAGATACTGGCGGCAGAAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027402.2-556s1c1
Sequence:CCGGCGAGCCCAATAACAACAAGGACTCGAGTCCTTGTTGTTATTGGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027402
FNDC5 MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027402.2-1217s1c1
Sequence:CCGGCCCTCTGTGAACATCATCAAACTCGAGTTTGATGATGTTCACAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027402.2-302s1c1
Sequence:CCGGGACACAGAATATATCGTCCATCTCGAGATGGACGATATATTCTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027402.2-230s1c1
Sequence:CCGGGTGCGGATGCTCCGGTTCATTCTCGAGAATGAACCGGAGCATCCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027402.2-518s1c1
Sequence:CCGGGCTCTCTTCTGCCGCCAGTATCTCGAGATACTGGCGGCAGAAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027402.2-556s1c1
Sequence:CCGGCGAGCCCAATAACAACAAGGACTCGAGTCCTTGTTGTTATTGGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027402
FNDC5 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027402.2-1217s1c1
Sequence:CCGGCCCTCTGTGAACATCATCAAACTCGAGTTTGATGATGTTCACAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027402.2-302s1c1
Sequence:CCGGGACACAGAATATATCGTCCATCTCGAGATGGACGATATATTCTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027402.2-230s1c1
Sequence:CCGGGTGCGGATGCTCCGGTTCATTCTCGAGAATGAACCGGAGCATCCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027402.2-518s1c1
Sequence:CCGGGCTCTCTTCTGCCGCCAGTATCTCGAGATACTGGCGGCAGAAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027402.2-556s1c1
Sequence:CCGGCGAGCCCAATAACAACAAGGACTCGAGTCCTTGTTGTTATTGGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153756
FNDC5 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153756.1-286s1c1
Sequence:CCGGGAGGAGGATACGGAGTACATACTCGAGTATGTACTCCGTATCCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153756.1-1071s1c1
Sequence:CCGGCCTTCCTTCTTCTGTCCTGTTCTCGAGAACAGGACAGAAGAAGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153756.1-398s1c1
Sequence:CCGGCCAAGAACAAAGATGAGGTAACTCGAGTTACCTCATCTTTGTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153756.1-405s1c1
Sequence:CCGGCAAAGATGAGGTAACCATGAACTCGAGTTCATGGTTACCTCATCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153756.1-390s1c1
Sequence:CCGGGATGGCCTCCAAGAACAAAGACTCGAGTCTTTGTTCTTGGAGGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153756.1-537s1c1
Sequence:CCGGCAAGGACAATGAACCCAATAACTCGAGTTATTGGGTTCATTGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153756.1-402s1c1
Sequence:CCGGGAACAAAGATGAGGTAACCATCTCGAGATGGTTACCTCATCTTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153756
FNDC5 MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153756.1-286s1c1
Sequence:CCGGGAGGAGGATACGGAGTACATACTCGAGTATGTACTCCGTATCCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153756.1-1071s1c1
Sequence:CCGGCCTTCCTTCTTCTGTCCTGTTCTCGAGAACAGGACAGAAGAAGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153756.1-398s1c1
Sequence:CCGGCCAAGAACAAAGATGAGGTAACTCGAGTTACCTCATCTTTGTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153756.1-405s1c1
Sequence:CCGGCAAAGATGAGGTAACCATGAACTCGAGTTCATGGTTACCTCATCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153756.1-390s1c1
Sequence:CCGGGATGGCCTCCAAGAACAAAGACTCGAGTCTTTGTTCTTGGAGGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153756.1-537s1c1
Sequence:CCGGCAAGGACAATGAACCCAATAACTCGAGTTATTGGGTTCATTGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153756.1-402s1c1
Sequence:CCGGGAACAAAGATGAGGTAACCATCTCGAGATGGTTACCTCATCTTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153756
FNDC5 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153756.1-286s1c1
Sequence:CCGGGAGGAGGATACGGAGTACATACTCGAGTATGTACTCCGTATCCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153756.1-1071s1c1
Sequence:CCGGCCTTCCTTCTTCTGTCCTGTTCTCGAGAACAGGACAGAAGAAGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153756.1-398s1c1
Sequence:CCGGCCAAGAACAAAGATGAGGTAACTCGAGTTACCTCATCTTTGTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153756.1-405s1c1
Sequence:CCGGCAAAGATGAGGTAACCATGAACTCGAGTTCATGGTTACCTCATCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153756.1-390s1c1
Sequence:CCGGGATGGCCTCCAAGAACAAAGACTCGAGTCTTTGTTCTTGGAGGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153756.1-537s1c1
Sequence:CCGGCAAGGACAATGAACCCAATAACTCGAGTTATTGGGTTCATTGTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153756.1-402s1c1
Sequence:CCGGGAACAAAGATGAGGTAACCATCTCGAGATGGTTACCTCATCTTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)