EMAIL THIS PAGE TO A FRIEND

FNDC7

fibronectin type III domain containing 7

130 Gene Product Result for
Synonyms: RP11-293A10.2
UniProtKB ID: Q5VTL7, A1L468, E9PAZ5, Q6PF16, Q8NA51
Gene ID:
Mouse(320181) fibronectin type III domain containing 7
Rat(310787) fibronectin type III domain containing 7
chicken(424339) fibronectin type III domain containing 7
dog(490129) fibronectin type III domain containing 7
domestic cat(101096584) fibronectin type III domain containing 7
cow(100299981) fibronectin type III domain containing 7
Horse(100060739) fibronectin type III domain containing 7
domestic guinea pig(100726897) fibronectin type III domain containing 7
naked mole-rat(101709287) fibronectin type III domain containing 7
sheep(101122147) fibronectin type III domain containing 7
Domestic Rabbit(100343067) fibronectin type III domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173532 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173532 Rosetta Predictions human pricing
NM_001107717 Rosetta Predictions rat pricing
XM_227591 Rosetta Predictions rat pricing
NM_177091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056525 predicted 255
2 SASI_Hs01_00056526 predicted 1146
3 SASI_Hs01_00056527 predicted 1174
4 SASI_Hs01_00056528 predicted 762
5 SASI_Hs02_00368324 predicted 1170
6 SASI_Hs01_00056530 predicted 726
7 SASI_Hs01_00056531 predicted 598
8 SASI_Hs01_00056533 predicted 396
9 SASI_Hs01_00056534 predicted 775
10 SASI_Hs02_00368325 predicted 816
11 SASI_Hs01_00056529 predicted 310
12 SASI_Hs01_00056532 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231575 predicted 947
2 SASI_Rn02_00231576 predicted 1606
3 SASI_Rn02_00231577 predicted 1961
4 SASI_Rn02_00231578 predicted 1582
5 SASI_Rn02_00231579 predicted 336
6 SASI_Rn02_00231580 predicted 1236
7 SASI_Rn02_00231581 predicted 395
8 SASI_Rn02_00231582 predicted 1438
9 SASI_Rn02_00231583 predicted 724
10 SASI_Rn02_00231584 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139112 predicted 942
2 SASI_Rn01_00139113 predicted 1602
3 SASI_Rn01_00139114 predicted 1969
4 SASI_Rn01_00139115 predicted 1584
5 SASI_Rn01_00139116 predicted 335
6 SASI_Rn01_00139117 predicted 1235
7 SASI_Rn01_00139118 predicted 392
8 SASI_Rn01_00139119 predicted 803
9 SASI_Rn01_00139120 predicted 1445
10 SASI_Rn01_00139121 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040855 predicted 1375
2 SASI_Mm02_00347084 predicted 1748
3 SASI_Mm01_00040856 predicted 354
4 SASI_Mm01_00040857 predicted 1828
5 SASI_Mm01_00040858 predicted 945
6 SASI_Mm01_00040859 predicted 332
7 SASI_Mm01_00040860 predicted 1902
8 SASI_Mm01_00040861 predicted 1120
9 SASI_Mm01_00040862 predicted 1984
10 SASI_Mm01_00040863 predicted 2017
11 SASI_Mm01_00040854 predicted 1107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177091
FNDC7 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177091.2-2023s1c1
Sequence:CCGGGCCTATCAAAGTTACTCTTCTCTCGAGAGAAGAGTAACTTTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177091.2-2024s1c1
Sequence:CCGGCCTATCAAAGTTACTCTTCTACTCGAGTAGAAGAGTAACTTTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177091.2-2464s1c1
Sequence:CCGGGCAAAGCTCCTTTGCGCTTTACTCGAGTAAAGCGCAAAGGAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177091.3-1967s21c1
Sequence:CCGGCAACTACACGGTGGCGTTAAACTCGAGTTTAACGCCACCGTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177091.3-1241s21c1
Sequence:CCGGGAGTCCTCTGGGCGATGTATTCTCGAGAATACATCGCCCAGAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177091.3-679s21c1
Sequence:CCGGCCGGAACTCTCTACACTATAACTCGAGTTATAGTGTAGAGAGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177091.3-2420s21c1
Sequence:CCGGGCCATGGAAACTCGCTATTAGCTCGAGCTAATAGCGAGTTTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177091.3-1092s21c1
Sequence:CCGGGTGGAGCTGGGTGACTATTATCTCGAGATAATAGTCACCCAGCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177091
FNDC7 MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177091.2-2023s1c1
Sequence:CCGGGCCTATCAAAGTTACTCTTCTCTCGAGAGAAGAGTAACTTTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177091.2-2024s1c1
Sequence:CCGGCCTATCAAAGTTACTCTTCTACTCGAGTAGAAGAGTAACTTTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177091.2-2464s1c1
Sequence:CCGGGCAAAGCTCCTTTGCGCTTTACTCGAGTAAAGCGCAAAGGAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177091.3-1967s21c1
Sequence:CCGGCAACTACACGGTGGCGTTAAACTCGAGTTTAACGCCACCGTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177091.3-1241s21c1
Sequence:CCGGGAGTCCTCTGGGCGATGTATTCTCGAGAATACATCGCCCAGAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177091.3-679s21c1
Sequence:CCGGCCGGAACTCTCTACACTATAACTCGAGTTATAGTGTAGAGAGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177091.3-2420s21c1
Sequence:CCGGGCCATGGAAACTCGCTATTAGCTCGAGCTAATAGCGAGTTTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177091.3-1092s21c1
Sequence:CCGGGTGGAGCTGGGTGACTATTATCTCGAGATAATAGTCACCCAGCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177091
FNDC7 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177091.2-2023s1c1
Sequence:CCGGGCCTATCAAAGTTACTCTTCTCTCGAGAGAAGAGTAACTTTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177091.2-2024s1c1
Sequence:CCGGCCTATCAAAGTTACTCTTCTACTCGAGTAGAAGAGTAACTTTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177091.2-2464s1c1
Sequence:CCGGGCAAAGCTCCTTTGCGCTTTACTCGAGTAAAGCGCAAAGGAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177091.3-1967s21c1
Sequence:CCGGCAACTACACGGTGGCGTTAAACTCGAGTTTAACGCCACCGTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177091.3-1241s21c1
Sequence:CCGGGAGTCCTCTGGGCGATGTATTCTCGAGAATACATCGCCCAGAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177091.3-679s21c1
Sequence:CCGGCCGGAACTCTCTACACTATAACTCGAGTTATAGTGTAGAGAGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177091.3-2420s21c1
Sequence:CCGGGCCATGGAAACTCGCTATTAGCTCGAGCTAATAGCGAGTTTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177091.3-1092s21c1
Sequence:CCGGGTGGAGCTGGGTGACTATTATCTCGAGATAATAGTCACCCAGCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173532
FNDC7 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173532.1-2212s1c1
Sequence:CCGGGCATGAGAGAAGATGTCAAATCTCGAGATTTGACATCTTCTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173532.1-1113s1c1
Sequence:CCGGGCATCACATGTGGCATCAATTCTCGAGAATTGATGCCACATGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173532.1-1474s1c1
Sequence:CCGGCTCTGGAAGTACACTTGGAATCTCGAGATTCCAAGTGTACTTCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173532.1-129s1c1
Sequence:CCGGCAAGTAATGATGCTGGATCTACTCGAGTAGATCCAGCATCATTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173532.1-765s1c1
Sequence:CCGGCCACTAATGATGATGCTACTTCTCGAGAAGTAGCATCATCATTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173532.1-441s1c1
Sequence:CCGGCCTGTTGTCCTAGTGACATTACTCGAGTAATGTCACTAGGACAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173532.1-128s1c1
Sequence:CCGGGCAAGTAATGATGCTGGATCTCTCGAGAGATCCAGCATCATTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173532
FNDC7 MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173532.1-2212s1c1
Sequence:CCGGGCATGAGAGAAGATGTCAAATCTCGAGATTTGACATCTTCTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173532.1-1113s1c1
Sequence:CCGGGCATCACATGTGGCATCAATTCTCGAGAATTGATGCCACATGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173532.1-1474s1c1
Sequence:CCGGCTCTGGAAGTACACTTGGAATCTCGAGATTCCAAGTGTACTTCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173532.1-129s1c1
Sequence:CCGGCAAGTAATGATGCTGGATCTACTCGAGTAGATCCAGCATCATTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173532.1-765s1c1
Sequence:CCGGCCACTAATGATGATGCTACTTCTCGAGAAGTAGCATCATCATTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173532.1-441s1c1
Sequence:CCGGCCTGTTGTCCTAGTGACATTACTCGAGTAATGTCACTAGGACAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173532.1-128s1c1
Sequence:CCGGGCAAGTAATGATGCTGGATCTCTCGAGAGATCCAGCATCATTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173532
FNDC7 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173532.1-2212s1c1
Sequence:CCGGGCATGAGAGAAGATGTCAAATCTCGAGATTTGACATCTTCTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173532.1-1113s1c1
Sequence:CCGGGCATCACATGTGGCATCAATTCTCGAGAATTGATGCCACATGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173532.1-1474s1c1
Sequence:CCGGCTCTGGAAGTACACTTGGAATCTCGAGATTCCAAGTGTACTTCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173532.1-129s1c1
Sequence:CCGGCAAGTAATGATGCTGGATCTACTCGAGTAGATCCAGCATCATTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173532.1-765s1c1
Sequence:CCGGCCACTAATGATGATGCTACTTCTCGAGAAGTAGCATCATCATTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173532.1-441s1c1
Sequence:CCGGCCTGTTGTCCTAGTGACATTACTCGAGTAATGTCACTAGGACAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173532.1-128s1c1
Sequence:CCGGGCAAGTAATGATGCTGGATCTCTCGAGAGATCCAGCATCATTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks