EMAIL THIS PAGE TO A FRIEND

FNDC8

fibronectin type III domain containing 8

84 Gene Product Result for
UniProtKB ID: Q8TC99, B2R9G6, Q9UFC2
Gene ID:
Mouse(78919) fibronectin type III domain containing 8
Rat(303376) fibronectin type III domain containing 8
sheep(101117943) fibronectin type III domain containing 8
naked mole-rat(101703489) fibronectin type III domain containing 8
domestic guinea pig(100715133) fibronectin type III domain containing 8
dog(480607) fibronectin type III domain containing 8
cow(617117) fibronectin type III domain containing 8
domestic cat(101098756) fibronectin type III domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017559 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017559 Rosetta Predictions human pricing
NM_001107030 Rosetta Predictions rat pricing
XM_220774 Rosetta Predictions rat pricing
NM_030224 Rosetta Predictions mouse pricing
XM_001005358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134320 predicted 769
2 SASI_Hs01_00134321 predicted 760
3 SASI_Hs01_00134322 predicted 285
4 SASI_Hs01_00134324 predicted 911
5 SASI_Hs01_00134325 predicted 1032
6 SASI_Hs01_00134326 predicted 771
7 SASI_Hs01_00134327 predicted 745
8 SASI_Hs01_00134328 predicted 702
9 SASI_Hs01_00134329 predicted 809
10 SASI_Hs02_00350206 predicted 231
11 SASI_Hs01_00134323 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224796 predicted 706
2 SASI_Rn02_00224797 predicted 416
3 SASI_Rn02_00224798 predicted 1104
4 SASI_Rn02_00224799 predicted 642
5 SASI_Rn02_00224800 predicted 1015
6 SASI_Rn02_00224801 predicted 302
7 SASI_Rn02_00224802 predicted 293
8 SASI_Rn02_00224803 predicted 720
9 SASI_Rn02_00224804 predicted 874
10 SASI_Rn02_00224805 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183984 predicted 603
2 SASI_Rn01_00183985 predicted 569
3 SASI_Rn01_00183986 predicted 489
4 SASI_Rn01_00183987 predicted 579
5 SASI_Rn01_00183988 predicted 559
6 SASI_Rn01_00183989 predicted 556
7 SASI_Rn01_00183990 predicted 602
8 SASI_Rn01_00183991 predicted 557
9 SASI_Rn01_00183992 predicted 499
10 SASI_Rn01_00183993 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336657 predicted 697
2 SASI_Mm02_00336658 predicted 883
3 SASI_Mm02_00336659 predicted 991
4 SASI_Mm02_00336660 predicted 1106
5 SASI_Mm02_00336661 predicted 275
6 SASI_Mm02_00336662 predicted 757
7 SASI_Mm02_00336663 predicted 1085
8 SASI_Mm02_00336664 predicted 870
9 SASI_Mm02_00336665 predicted 619
10 SASI_Mm02_00336666 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231602 predicted 270
2 SASI_Mm01_00231603 predicted 300
3 SASI_Mm01_00231604 predicted 290
4 SASI_Mm01_00231605 predicted 434
5 SASI_Mm01_00231606 predicted 277
6 SASI_Mm01_00231607 predicted 295
7 SASI_Mm01_00231608 predicted 338
8 SASI_Mm01_00231609 predicted 430
9 SASI_Mm01_00231610 predicted 441
10 SASI_Mm01_00231611 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030224
FNDC8 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030224.1-574s21c1
Sequence:CCGGTGCCAGAGGTTCCGTTCATTTCTCGAGAAATGAACGGAACCTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030224.1-1788s21c1
Sequence:CCGGCTACCAGGCAGACGCAGAAATCTCGAGATTTCTGCGTCTGCCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030224.1-245s21c1
Sequence:CCGGCACCGATGTCATGATGCATATCTCGAGATATGCATCATGACATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030224.1-288s21c1
Sequence:CCGGAGCTCGGATGACACGAGTATGCTCGAGCATACTCGTGTCATCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030224.1-847s21c1
Sequence:CCGGGGTGCAAGCCCTATAAGTTTGCTCGAGCAAACTTATAGGGCTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030224
FNDC8 MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030224.1-574s21c1
Sequence:CCGGTGCCAGAGGTTCCGTTCATTTCTCGAGAAATGAACGGAACCTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030224.1-1788s21c1
Sequence:CCGGCTACCAGGCAGACGCAGAAATCTCGAGATTTCTGCGTCTGCCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030224.1-245s21c1
Sequence:CCGGCACCGATGTCATGATGCATATCTCGAGATATGCATCATGACATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030224.1-288s21c1
Sequence:CCGGAGCTCGGATGACACGAGTATGCTCGAGCATACTCGTGTCATCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030224.1-847s21c1
Sequence:CCGGGGTGCAAGCCCTATAAGTTTGCTCGAGCAAACTTATAGGGCTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030224
FNDC8 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030224.1-574s21c1
Sequence:CCGGTGCCAGAGGTTCCGTTCATTTCTCGAGAAATGAACGGAACCTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030224.1-1788s21c1
Sequence:CCGGCTACCAGGCAGACGCAGAAATCTCGAGATTTCTGCGTCTGCCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030224.1-245s21c1
Sequence:CCGGCACCGATGTCATGATGCATATCTCGAGATATGCATCATGACATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030224.1-288s21c1
Sequence:CCGGAGCTCGGATGACACGAGTATGCTCGAGCATACTCGTGTCATCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030224.1-847s21c1
Sequence:CCGGGGTGCAAGCCCTATAAGTTTGCTCGAGCAAACTTATAGGGCTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017559
FNDC8 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 8
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017559.2-236s21c1
Sequence:CCGGCTAGCCTCAAAGGGCAATTTGCTCGAGCAAATTGCCCTTTGAGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017559.2-824s21c1
Sequence:CCGGCTAAAGCCTAACACGTGTTACCTCGAGGTAACACGTGTTAGGCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017559.2-1121s21c1
Sequence:CCGGGAGCCATGAGACCTACCATACCTCGAGGTATGGTAGGTCTCATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017559.2-885s21c1
Sequence:CCGGAGTGGTGCAAGCCCTACAAATCTCGAGATTTGTAGGGCTTGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017559.2-636s21c1
Sequence:CCGGTTGAGCACACCGTCAACAATTCTCGAGAATTGTTGACGGTGTGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017559.1-220s1c1
Sequence:CCGGGAGGATGATACCATCAACCTACTCGAGTAGGTTGATGGTATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017559
FNDC8 MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 8
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017559.2-236s21c1
Sequence:CCGGCTAGCCTCAAAGGGCAATTTGCTCGAGCAAATTGCCCTTTGAGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017559.2-824s21c1
Sequence:CCGGCTAAAGCCTAACACGTGTTACCTCGAGGTAACACGTGTTAGGCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017559.2-1121s21c1
Sequence:CCGGGAGCCATGAGACCTACCATACCTCGAGGTATGGTAGGTCTCATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017559.2-885s21c1
Sequence:CCGGAGTGGTGCAAGCCCTACAAATCTCGAGATTTGTAGGGCTTGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017559.2-636s21c1
Sequence:CCGGTTGAGCACACCGTCAACAATTCTCGAGAATTGTTGACGGTGTGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017559.1-220s1c1
Sequence:CCGGGAGGATGATACCATCAACCTACTCGAGTAGGTTGATGGTATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017559
FNDC8 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 8
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017559.2-236s21c1
Sequence:CCGGCTAGCCTCAAAGGGCAATTTGCTCGAGCAAATTGCCCTTTGAGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017559.2-824s21c1
Sequence:CCGGCTAAAGCCTAACACGTGTTACCTCGAGGTAACACGTGTTAGGCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017559.2-1121s21c1
Sequence:CCGGGAGCCATGAGACCTACCATACCTCGAGGTATGGTAGGTCTCATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017559.2-885s21c1
Sequence:CCGGAGTGGTGCAAGCCCTACAAATCTCGAGATTTGTAGGGCTTGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017559.2-636s21c1
Sequence:CCGGTTGAGCACACCGTCAACAATTCTCGAGAATTGTTGACGGTGTGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017559.1-220s1c1
Sequence:CCGGGAGGATGATACCATCAACCTACTCGAGTAGGTTGATGGTATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks