EMAIL THIS PAGE TO A FRIEND

FNDC9

fibronectin type III domain containing 9

38 Gene Product Result for
Synonyms: C5orf40
UniProtKB ID: Q8TBE3, A8K0Y6
Gene ID:
Mouse(320116) fibronectin type III domain containing 9
Rat(100362205) fibronectin type III domain containing 9
chicken(100857510) fibronectin type III domain containing 9
cow(101906529) fibronectin type III domain containing 9
domestic cat(101080359) fibronectin type III domain containing 9
dog(489158) fibronectin type III domain containing 9
domestic guinea pig(101789051) fibronectin type III domain containing 9
naked mole-rat(101708246) fibronectin type III domain containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001343 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001343 Rosetta Predictions human pricing
NM_177075 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162627 predicted 880
2 SASI_Hs01_00162628 predicted 435
3 SASI_Hs01_00162630 predicted 956
4 SASI_Hs01_00162629 predicted 338
5 SASI_Hs02_00303723 predicted 199
6 SASI_Hs01_00162632 predicted 1089
7 SASI_Hs01_00162633 predicted 915
8 SASI_Hs01_00162634 predicted 786
9 SASI_Hs01_00162636 predicted 750
10 SASI_Hs02_00303724 predicted 406
11 SASI_Hs01_00162631 predicted 864
12 SASI_Hs01_00162635 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156211 predicted 767
2 SASI_Mm01_00156212 predicted 816
3 SASI_Mm01_00156214 predicted 465
4 SASI_Mm01_00156215 predicted 665
5 SASI_Mm01_00156216 predicted 926
6 SASI_Mm02_00347054 predicted 262
7 SASI_Mm01_00156218 predicted 651
8 SASI_Mm01_00156219 predicted 823
9 SASI_Mm01_00156220 predicted 914
10 SASI_Mm02_00347055 predicted 756
11 SASI_Mm01_00156213 predicted 845
12 SASI_Mm01_00156217 predicted 845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001343
FNDC9 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001343.1-910s1c1
Sequence:CCGGCCATCAAACGTCACTGCTATTCTCGAGAATAGCAGTGACGTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001343.1-349s1c1
Sequence:CCGGCTCTCTACTTCCTGTGCATCACTCGAGTGATGCACAGGAAGTAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001343.1-248s1c1
Sequence:CCGGGAACAGCATCTTCTCTGGCTACTCGAGTAGCCAGAGAAGATGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001343.1-241s1c1
Sequence:CCGGCCAACTGGAACAGCATCTTCTCTCGAGAGAAGATGCTGTTCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001343.1-1350s1c1
Sequence:CCGGCCATGGATTATCTTCACTATTCTCGAGAATAGTGAAGATAATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001343
FNDC9 MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001343.1-910s1c1
Sequence:CCGGCCATCAAACGTCACTGCTATTCTCGAGAATAGCAGTGACGTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001343.1-349s1c1
Sequence:CCGGCTCTCTACTTCCTGTGCATCACTCGAGTGATGCACAGGAAGTAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001343.1-248s1c1
Sequence:CCGGGAACAGCATCTTCTCTGGCTACTCGAGTAGCCAGAGAAGATGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001343.1-241s1c1
Sequence:CCGGCCAACTGGAACAGCATCTTCTCTCGAGAGAAGATGCTGTTCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001343.1-1350s1c1
Sequence:CCGGCCATGGATTATCTTCACTATTCTCGAGAATAGTGAAGATAATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001343
FNDC9 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001343.1-910s1c1
Sequence:CCGGCCATCAAACGTCACTGCTATTCTCGAGAATAGCAGTGACGTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001343.1-349s1c1
Sequence:CCGGCTCTCTACTTCCTGTGCATCACTCGAGTGATGCACAGGAAGTAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001343.1-248s1c1
Sequence:CCGGGAACAGCATCTTCTCTGGCTACTCGAGTAGCCAGAGAAGATGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001343.1-241s1c1
Sequence:CCGGCCAACTGGAACAGCATCTTCTCTCGAGAGAAGATGCTGTTCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001343.1-1350s1c1
Sequence:CCGGCCATGGATTATCTTCACTATTCTCGAGAATAGTGAAGATAATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177075
FNDC9 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III domain containing 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177075.2-117s1c1
Sequence:CCGGCTTGGAGGACTATTACCATATCTCGAGATATGGTAATAGTCCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177075.2-156s1c1
Sequence:CCGGGAACAGTATCTTCTCCGGATACTCGAGTATCCGGAGAAGATACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177075.2-959s1c1
Sequence:CCGGCGGAAGACTCTGTTTCAGTATCTCGAGATACTGAAACAGAGTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177075.2-2010s1c1
Sequence:CCGGGCCTTTAAGCTCTGTCTGTAACTCGAGTTACAGACAGAGCTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177075.2-918s1c1
Sequence:CCGGGCATTGTTTCAGTATTGTCTACTCGAGTAGACAATACTGAAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177075
FNDC9 MISSION shRNA shRNA Plasmid DNA
fibronectin type III domain containing 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177075.2-117s1c1
Sequence:CCGGCTTGGAGGACTATTACCATATCTCGAGATATGGTAATAGTCCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177075.2-156s1c1
Sequence:CCGGGAACAGTATCTTCTCCGGATACTCGAGTATCCGGAGAAGATACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177075.2-959s1c1
Sequence:CCGGCGGAAGACTCTGTTTCAGTATCTCGAGATACTGAAACAGAGTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177075.2-2010s1c1
Sequence:CCGGGCCTTTAAGCTCTGTCTGTAACTCGAGTTACAGACAGAGCTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177075.2-918s1c1
Sequence:CCGGGCATTGTTTCAGTATTGTCTACTCGAGTAGACAATACTGAAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177075
FNDC9 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III domain containing 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177075.2-117s1c1
Sequence:CCGGCTTGGAGGACTATTACCATATCTCGAGATATGGTAATAGTCCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177075.2-156s1c1
Sequence:CCGGGAACAGTATCTTCTCCGGATACTCGAGTATCCGGAGAAGATACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177075.2-959s1c1
Sequence:CCGGCGGAAGACTCTGTTTCAGTATCTCGAGATACTGAAACAGAGTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177075.2-2010s1c1
Sequence:CCGGGCCTTTAAGCTCTGTCTGTAACTCGAGTTACAGACAGAGCTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177075.2-918s1c1
Sequence:CCGGGCATTGTTTCAGTATTGTCTACTCGAGTAGACAATACTGAAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks