EMAIL THIS PAGE TO A FRIEND

FNIP2

folliculin interacting protein 2

68 Gene Product Result for
Synonyms: FNIPL MAPO1
UniProtKB ID: Q9P278, Q05DC3, Q96I31, Q9H994
Gene ID:
Mouse(329679) folliculin interacting protein 2
Rat(310538) folliculin interacting protein 2
domestic guinea pig(100724233) folliculin interacting protein 2
naked mole-rat(101717184) folliculin interacting protein 2
sheep(101111832) folliculin interacting protein 2
chicken(422417) folliculin interacting protein 2
cow(100138353) folliculin interacting protein 2
Horse(100069124) folliculin interacting protein 2
domestic cat(101087475) folliculin interacting protein 2
dog(475482) folliculin interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020840 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020840 Rosetta Predictions human pricing
XM_227287 Rosetta Predictions rat pricing
XM_907047 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354078 predicted 1215
2 SASI_Hs02_00354079 predicted 3032
3 SASI_Hs02_00354080 predicted 3003
4 SASI_Hs02_00354081 predicted 1486
5 SASI_Hs02_00354082 predicted 1435
6 SASI_Hs02_00354083 predicted 1265
7 SASI_Hs02_00354084 predicted 1081
8 SASI_Hs02_00354085 predicted 1614
9 SASI_Hs02_00354086 predicted 2340
10 SASI_Hs02_00354087 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384207 predicted 2970
2 SASI_Rn02_00384208 predicted 2810
3 SASI_Rn02_00384209 predicted 2140
4 SASI_Rn02_00384210 predicted 3020
5 SASI_Rn02_00384211 predicted 3404
6 SASI_Rn02_00384212 predicted 2440
7 SASI_Rn02_00384213 predicted 3378
8 SASI_Rn02_00384214 predicted 2184
9 SASI_Rn02_00384215 predicted 3044
10 SASI_Rn02_00384216 predicted 2612
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432999 predicted 1444
2 SASI_Mm02_00433000 predicted 956
3 SASI_Mm02_00433001 predicted 547
4 SASI_Mm02_00433002 predicted 949
5 SASI_Mm02_00433003 predicted 1385
6 SASI_Mm02_00433004 predicted 1604
7 SASI_Mm02_00433005 predicted 1557
8 SASI_Mm02_00433006 predicted 971
9 SASI_Mm02_00433007 predicted 2744
10 SASI_Mm02_00433008 predicted 2768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020840
FNIP2 MISSION shRNA Bacterial Glycerol Stock
folliculin interacting protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020840.1-1490s21c1
Sequence:CCGGCCTTACTGACTGCGGTGTTAACTCGAGTTAACACCGCAGTCAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020840.1-2002s21c1
Sequence:CCGGAGTAGAGACCTGGGTCTTAAACTCGAGTTTAAGACCCAGGTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020840.1-5247s21c1
Sequence:CCGGCCGTTTCTCATTACGTGTAAACTCGAGTTTACACGTAATGAGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020840.1-1826s21c1
Sequence:CCGGTAAATGGGAGCAAGATCATAACTCGAGTTATGATCTTGCTCCCATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020840.1-673s21c1
Sequence:CCGGCCACAACTGATGATTAGTAAACTCGAGTTTACTAATCATCAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020840
FNIP2 MISSION shRNA shRNA Plasmid DNA
folliculin interacting protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020840.1-1490s21c1
Sequence:CCGGCCTTACTGACTGCGGTGTTAACTCGAGTTAACACCGCAGTCAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020840.1-2002s21c1
Sequence:CCGGAGTAGAGACCTGGGTCTTAAACTCGAGTTTAAGACCCAGGTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020840.1-5247s21c1
Sequence:CCGGCCGTTTCTCATTACGTGTAAACTCGAGTTTACACGTAATGAGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020840.1-1826s21c1
Sequence:CCGGTAAATGGGAGCAAGATCATAACTCGAGTTATGATCTTGCTCCCATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020840.1-673s21c1
Sequence:CCGGCCACAACTGATGATTAGTAAACTCGAGTTTACTAATCATCAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020840
FNIP2 MISSION shRNA Lentiviral Transduction Particles
folliculin interacting protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020840.1-1490s21c1
Sequence:CCGGCCTTACTGACTGCGGTGTTAACTCGAGTTAACACCGCAGTCAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020840.1-2002s21c1
Sequence:CCGGAGTAGAGACCTGGGTCTTAAACTCGAGTTTAAGACCCAGGTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020840.1-5247s21c1
Sequence:CCGGCCGTTTCTCATTACGTGTAAACTCGAGTTTACACGTAATGAGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020840.1-1826s21c1
Sequence:CCGGTAAATGGGAGCAAGATCATAACTCGAGTTATGATCTTGCTCCCATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020840.1-673s21c1
Sequence:CCGGCCACAACTGATGATTAGTAAACTCGAGTTTACTAATCATCAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks