EMAIL THIS PAGE TO A FRIEND

FNTA

farnesyltransferase, CAAX box, alpha

Synonyms: FPTA PGGT1A PTAR2
UniProtKB ID: P49354, A6NJW0, Q53XJ9, Q9UDC1
Gene ID:
Human(2339) Summary: Prenyltransferases can attach either a farnesyl group or a geranylgeranyl group in thioether linkage to the cysteine residue of proteins with a C-terminal CAAX box. CAAX geranylgeranyltransferase and CAAX farnesyltransferase are heterodimers that share the same alpha subunit but have different beta subunits. This gene encodes the alpha subunit of these transferases. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, May 2010]
Mouse(14272) farnesyltransferase, CAAX box, alpha
Rat(25318) farnesyltransferase, CAAX box, alpha
Zebrafish(555882) farnesyltransferase, CAAX box, alpha
domestic cat(101097062) farnesyltransferase, CAAX box, alpha
cow(281169) farnesyltransferase, CAAX box, alpha
dog(475566) farnesyltransferase, CAAX box, alpha
chicken(427299) farnesyltransferase, CAAX box, alpha
sheep(100302086) farnesyltransferase, CAAX box, alpha
naked mole-rat(101703640) farnesyltransferase, CAAX box, alpha
domestic guinea pig(100718610) farnesyltransferase, CAAX box, alpha
153 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002027 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008033 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008033 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008033 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018676 Rosetta Predictions human pricing
NM_001018677 Rosetta Predictions human pricing
NM_002027 Rosetta Predictions human pricing
NM_012847 Rosetta Predictions rat pricing
NM_008033 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035095 predicted 955
2 SASI_Hs01_00035096 predicted 734
3 SASI_Hs01_00035097 predicted 772
4 SASI_Hs01_00035099 predicted 948
5 SASI_Hs01_00035100 predicted 676
6 SASI_Hs01_00035101 predicted 978
7 SASI_Hs01_00035102 predicted 727
8 SASI_Hs01_00035103 predicted 1078
9 SASI_Hs01_00035104 predicted 602
10 SASI_Hs02_00307049 predicted 939
11 SASI_Hs01_00035098 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105177 predicted 833
2 SASI_Hs01_00105178 predicted 618
3 SASI_Hs01_00105179 predicted 659
4 SASI_Hs01_00105181 predicted 838
5 SASI_Hs01_00105182 predicted 561
6 SASI_Hs01_00105183 predicted 867
7 SASI_Hs01_00105184 predicted 611
8 SASI_Hs01_00105185 predicted 963
9 SASI_Hs01_00105186 predicted 489
10 SASI_Hs02_00307050 predicted 820
11 SASI_Hs01_00105180 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203911 predicted 1037
2 SASI_Hs01_00203912 predicted 823
3 SASI_Hs01_00203913 predicted 858
4 SASI_Hs01_00203915 predicted 1036
5 SASI_Hs01_00203916 predicted 760
6 SASI_Hs01_00203917 predicted 1070
7 SASI_Hs01_00203918 predicted 813
8 SASI_Hs01_00203919 predicted 1165
9 SASI_Hs01_00203920 predicted 688
10 SASI_Hs02_00333047 predicted 1018
11 SASI_Hs01_00203914 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037177 predicted 582
2 SASI_Rn01_00037178 predicted 855
3 SASI_Rn01_00037179 predicted 691
4 SASI_Rn01_00037180 predicted 614
5 SASI_Rn02_00260318 predicted 768
6 SASI_Rn01_00037181 predicted 1225
7 SASI_Rn02_00260319 predicted 825
8 SASI_Rn01_00037182 predicted 886
9 SASI_Rn01_00037184 predicted 619
10 SASI_Rn01_00037185 predicted 1164
11 SASI_Rn01_00037176 predicted 438
12 SASI_Rn01_00037183 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116727 predicted 471
2 SASI_Mm01_00116728 predicted 532
3 SASI_Mm01_00116729 predicted 1209
4 SASI_Mm01_00116730 predicted 547
5 SASI_Mm01_00116731 predicted 367
6 SASI_Mm01_00116732 predicted 646
7 SASI_Mm01_00116733 predicted 848
8 SASI_Mm01_00116734 predicted 728
9 SASI_Mm01_00116735 predicted 397
10 SASI_Mm01_00116736 predicted 1132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002027
VALIDATED
FNTA MISSION shRNA Bacterial Glycerol Stock
farnesyltransferase, CAAX box, alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002027.2-761s21c1
Sequence:CCGGACCAAAGATACTTCGTTATTTCTCGAGAAATAACGAAGTATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002027.2-422s21c1
Sequence:CCGGAGTTAAATGCAGCCAATTATACTCGAGTATAATTGGCTGCATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002027.2-973s21c1
Sequence:CCGGCCCTACCTAATTGCCTTTCTTCTCGAGAAGAAAGGCAATTAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002027.2-302s21c1
Sequence:CCGGATCCCGTGGTCCAGATCATTTCTCGAGAAATGATCTGGACCACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002027.2-1626s21c1
Sequence:CCGGCTATCACTGTAACCAACTAATCTCGAGATTAGTTGGTTACAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002027.1-931s1c1
Sequence:CCGGCCCTACCTAATTGCCTTTCTTCTCGAGAAGAAAGGCAATTAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002027.1-752s1c1
Sequence:CCGGGCTACAATGATCGTGCTGTATCTCGAGATACAGCACGATCATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002027.1-365s1c1
Sequence:CCGGCCCGGGATGCTATTGAGTTAACTCGAGTTAACTCAATAGCATCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002027.1-262s1c1
Sequence:CCGGCCCGTGGTCCAGATCATTTATCTCGAGATAAATGATCTGGACCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002027.1-574s1c1
Sequence:CCGGGCTGATATTCTTAATCAGGATCTCGAGATCCTGATTAAGAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002027
VALIDATED
FNTA MISSION shRNA shRNA Plasmid DNA
farnesyltransferase, CAAX box, alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002027.2-761s21c1
Sequence:CCGGACCAAAGATACTTCGTTATTTCTCGAGAAATAACGAAGTATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002027.2-422s21c1
Sequence:CCGGAGTTAAATGCAGCCAATTATACTCGAGTATAATTGGCTGCATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002027.2-973s21c1
Sequence:CCGGCCCTACCTAATTGCCTTTCTTCTCGAGAAGAAAGGCAATTAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002027.2-302s21c1
Sequence:CCGGATCCCGTGGTCCAGATCATTTCTCGAGAAATGATCTGGACCACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002027.2-1626s21c1
Sequence:CCGGCTATCACTGTAACCAACTAATCTCGAGATTAGTTGGTTACAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002027.1-931s1c1
Sequence:CCGGCCCTACCTAATTGCCTTTCTTCTCGAGAAGAAAGGCAATTAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002027.1-752s1c1
Sequence:CCGGGCTACAATGATCGTGCTGTATCTCGAGATACAGCACGATCATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002027.1-365s1c1
Sequence:CCGGCCCGGGATGCTATTGAGTTAACTCGAGTTAACTCAATAGCATCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002027.1-262s1c1
Sequence:CCGGCCCGTGGTCCAGATCATTTATCTCGAGATAAATGATCTGGACCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002027.1-574s1c1
Sequence:CCGGGCTGATATTCTTAATCAGGATCTCGAGATCCTGATTAAGAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002027
VALIDATED
FNTA MISSION shRNA Lentiviral Transduction Particles
farnesyltransferase, CAAX box, alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002027.2-761s21c1
Sequence:CCGGACCAAAGATACTTCGTTATTTCTCGAGAAATAACGAAGTATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002027.2-422s21c1
Sequence:CCGGAGTTAAATGCAGCCAATTATACTCGAGTATAATTGGCTGCATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002027.2-973s21c1
Sequence:CCGGCCCTACCTAATTGCCTTTCTTCTCGAGAAGAAAGGCAATTAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002027.2-302s21c1
Sequence:CCGGATCCCGTGGTCCAGATCATTTCTCGAGAAATGATCTGGACCACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002027.2-1626s21c1
Sequence:CCGGCTATCACTGTAACCAACTAATCTCGAGATTAGTTGGTTACAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002027.1-931s1c1
Sequence:CCGGCCCTACCTAATTGCCTTTCTTCTCGAGAAGAAAGGCAATTAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002027.1-752s1c1
Sequence:CCGGGCTACAATGATCGTGCTGTATCTCGAGATACAGCACGATCATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002027.1-365s1c1
Sequence:CCGGCCCGGGATGCTATTGAGTTAACTCGAGTTAACTCAATAGCATCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002027.1-262s1c1
Sequence:CCGGCCCGTGGTCCAGATCATTTATCTCGAGATAAATGATCTGGACCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002027.1-574s1c1
Sequence:CCGGGCTGATATTCTTAATCAGGATCTCGAGATCCTGATTAAGAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008033
FNTA MISSION shRNA Bacterial Glycerol Stock
farnesyltransferase, CAAX box, alpha
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008033.2-226s1c1
Sequence:CCGGCAGAGCAGAATGGGCTGATATCTCGAGATATCAGCCCATTCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008033.2-1107s1c1
Sequence:CCGGCCCTTCAGAGTAAACACTGCACTCGAGTGCAGTGTTTACTCTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008033.2-1572s1c1
Sequence:CCGGGCTATCACTGTAACCAACTAACTCGAGTTAGTTGGTTACAGTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008033.2-478s1c1
Sequence:CCGGGAACTACATCACTGCGATAATCTCGAGATTATCGCAGTGATGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008033
FNTA MISSION shRNA shRNA Plasmid DNA
farnesyltransferase, CAAX box, alpha
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008033.2-226s1c1
Sequence:CCGGCAGAGCAGAATGGGCTGATATCTCGAGATATCAGCCCATTCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008033.2-1107s1c1
Sequence:CCGGCCCTTCAGAGTAAACACTGCACTCGAGTGCAGTGTTTACTCTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008033.2-1572s1c1
Sequence:CCGGGCTATCACTGTAACCAACTAACTCGAGTTAGTTGGTTACAGTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008033.2-478s1c1
Sequence:CCGGGAACTACATCACTGCGATAATCTCGAGATTATCGCAGTGATGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008033
FNTA MISSION shRNA Lentiviral Transduction Particles
farnesyltransferase, CAAX box, alpha
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008033.2-226s1c1
Sequence:CCGGCAGAGCAGAATGGGCTGATATCTCGAGATATCAGCCCATTCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008033.2-1107s1c1
Sequence:CCGGCCCTTCAGAGTAAACACTGCACTCGAGTGCAGTGTTTACTCTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008033.2-1572s1c1
Sequence:CCGGGCTATCACTGTAACCAACTAACTCGAGTTAGTTGGTTACAGTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008033.2-478s1c1
Sequence:CCGGGAACTACATCACTGCGATAATCTCGAGATTATCGCAGTGATGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks