EMAIL THIS PAGE TO A FRIEND

FNTAP1

farnesyltransferase, CAAX box, alpha pseudogene 1

Gene Product Result for
Synonyms: FNTAL1
Species: Human FNTAP1(283226)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_208554
FNTAP1 MISSION shRNA Bacterial Glycerol Stock
farnesyltransferase, CAAX box, alpha pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-301s1c1
Sequence:CCGGGTTTGTCACAATAGGCGAGTACTCGAGTACTCGCCTATTGTGACAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-609s1c1
Sequence:CCGGACCACATAATAGTTCATGGAACTCGAGTTCCATGAACTATTATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-545s1c1
Sequence:CCGGGCTACAATGATTGTGCTGTATCTCGAGATACAGCACAATCATTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-186s1c1
Sequence:CCGGCTATGTCCCGTACAGGCATTTCTCGAGAAATGCCTGTACGGGACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-316s1c1
Sequence:CCGGCGAGTAATAGTGGAATGGCTACTCGAGTAGCCATTCCACTATTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_208554
FNTAP1 MISSION shRNA shRNA Plasmid DNA
farnesyltransferase, CAAX box, alpha pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-301s1c1
Sequence:CCGGGTTTGTCACAATAGGCGAGTACTCGAGTACTCGCCTATTGTGACAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-609s1c1
Sequence:CCGGACCACATAATAGTTCATGGAACTCGAGTTCCATGAACTATTATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-545s1c1
Sequence:CCGGGCTACAATGATTGTGCTGTATCTCGAGATACAGCACAATCATTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-186s1c1
Sequence:CCGGCTATGTCCCGTACAGGCATTTCTCGAGAAATGCCTGTACGGGACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-316s1c1
Sequence:CCGGCGAGTAATAGTGGAATGGCTACTCGAGTAGCCATTCCACTATTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_208554
FNTAP1 MISSION shRNA Lentiviral Transduction Particles
farnesyltransferase, CAAX box, alpha pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-301s1c1
Sequence:CCGGGTTTGTCACAATAGGCGAGTACTCGAGTACTCGCCTATTGTGACAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-609s1c1
Sequence:CCGGACCACATAATAGTTCATGGAACTCGAGTTCCATGAACTATTATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-545s1c1
Sequence:CCGGGCTACAATGATTGTGCTGTATCTCGAGATACAGCACAATCATTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-186s1c1
Sequence:CCGGCTATGTCCCGTACAGGCATTTCTCGAGAAATGCCTGTACGGGACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208554.3-316s1c1
Sequence:CCGGCGAGTAATAGTGGAATGGCTACTCGAGTAGCCATTCCACTATTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)