EMAIL THIS PAGE TO A FRIEND

FNTB

farnesyltransferase, CAAX box, beta

66 Gene Product Result for
Synonyms: FPTB
UniProtKB ID: P49356, B2RDX6
Gene ID:
Mouse(110606) farnesyltransferase, CAAX box, beta
Rat(64511) farnesyltransferase, CAAX box, beta
Zebrafish(323500) farnesyltransferase, CAAX box, beta
domestic cat(101088759) farnesyltransferase, CAAX box, beta
cow(327686) farnesyltransferase, CAAX box, beta
dog(490735) farnesyltransferase, CAAX box, beta
chicken(100857683) farnesyltransferase, CAAX box, beta
domestic guinea pig(100718688) farnesyltransferase, CAAX box, beta
naked mole-rat(101703774) farnesyltransferase, CAAX box, beta
sheep(101110335) farnesyltransferase, CAAX box, beta
Domestic Rabbit(100341143) farnesyltransferase, CAAX box, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002028 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002028 Rosetta Predictions human pricing
NM_172034 Rosetta Predictions rat pricing
NM_145927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229245 predicted 1523
2 SASI_Hs01_00229246 predicted 951
3 SASI_Hs01_00229247 predicted 1009
4 SASI_Hs01_00229248 predicted 276
5 SASI_Hs01_00229249 predicted 1515
6 SASI_Hs01_00229251 predicted 1529
7 SASI_Hs01_00229252 predicted 611
8 SASI_Hs01_00229253 predicted 1548
9 SASI_Hs01_00229254 predicted 797
10 SASI_Hs02_00333048 predicted 358
11 SASI_Hs01_00229250 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044237 predicted 406
2 SASI_Rn01_00044238 predicted 835
3 SASI_Rn01_00044239 predicted 901
4 SASI_Rn01_00044240 predicted 507
5 SASI_Rn01_00044241 predicted 1462
6 SASI_Rn01_00044242 predicted 579
7 SASI_Rn01_00044243 predicted 894
8 SASI_Rn01_00044245 predicted 1092
9 SASI_Rn01_00044246 predicted 307
10 SASI_Rn02_00269124 predicted 570
11 SASI_Rn01_00044244 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116517 predicted 493
2 SASI_Mm01_00116518 predicted 1012
3 SASI_Mm01_00116520 predicted 1174
4 SASI_Mm01_00116521 predicted 832
5 SASI_Mm01_00116522 predicted 556
6 SASI_Mm01_00116523 predicted 291
7 SASI_Mm01_00116524 predicted 1333
8 SASI_Mm01_00116525 predicted 1096
9 SASI_Mm01_00116526 predicted 1000
10 SASI_Mm02_00341381 predicted 1187
11 SASI_Mm01_00116519 predicted 1380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002028
VALIDATED
FNTB MISSION shRNA Bacterial Glycerol Stock
farnesyltransferase, CAAX box, beta
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002028.3-836s1c1
Sequence:CCGGGCACTGCTGAATGGATAGCAACTCGAGTTGCTATCCATTCAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002028.3-980s1c1
Sequence:CCGGGCTTATTACAATGGGTGACAACTCGAGTTGTCACCCATTGTAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002028.3-1398s1c1
Sequence:CCGGCACTACATACTTTCTACAGAACTCGAGTTCTGTAGAAAGTATGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002028.3-424s1c1
Sequence:CCGGCGACAACTGACAGATGCCTATCTCGAGATAGGCATCTGTCAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002028.3-424s21c1
Sequence:CCGGCGACAACTGACAGATGCCTATCTCGAGATAGGCATCTGTCAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002028.3-1398s21c1
Sequence:CCGGCACTACATACTTTCTACAGAACTCGAGTTCTGTAGAAAGTATGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002028.3-836s21c1
Sequence:CCGGGCACTGCTGAATGGATAGCAACTCGAGTTGCTATCCATTCAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002028.3-294s21c1
Sequence:CCGGCACGTCCATAGAACAGGCAAACTCGAGTTTGCCTGTTCTATGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002028
VALIDATED
FNTB MISSION shRNA shRNA Plasmid DNA
farnesyltransferase, CAAX box, beta
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002028.3-836s1c1
Sequence:CCGGGCACTGCTGAATGGATAGCAACTCGAGTTGCTATCCATTCAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002028.3-980s1c1
Sequence:CCGGGCTTATTACAATGGGTGACAACTCGAGTTGTCACCCATTGTAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002028.3-1398s1c1
Sequence:CCGGCACTACATACTTTCTACAGAACTCGAGTTCTGTAGAAAGTATGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002028.3-424s1c1
Sequence:CCGGCGACAACTGACAGATGCCTATCTCGAGATAGGCATCTGTCAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002028.3-424s21c1
Sequence:CCGGCGACAACTGACAGATGCCTATCTCGAGATAGGCATCTGTCAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002028.3-1398s21c1
Sequence:CCGGCACTACATACTTTCTACAGAACTCGAGTTCTGTAGAAAGTATGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002028.3-836s21c1
Sequence:CCGGGCACTGCTGAATGGATAGCAACTCGAGTTGCTATCCATTCAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002028.3-294s21c1
Sequence:CCGGCACGTCCATAGAACAGGCAAACTCGAGTTTGCCTGTTCTATGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002028
VALIDATED
FNTB MISSION shRNA Lentiviral Transduction Particles
farnesyltransferase, CAAX box, beta
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002028.3-836s1c1
Sequence:CCGGGCACTGCTGAATGGATAGCAACTCGAGTTGCTATCCATTCAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002028.3-980s1c1
Sequence:CCGGGCTTATTACAATGGGTGACAACTCGAGTTGTCACCCATTGTAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002028.3-1398s1c1
Sequence:CCGGCACTACATACTTTCTACAGAACTCGAGTTCTGTAGAAAGTATGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002028.3-424s1c1
Sequence:CCGGCGACAACTGACAGATGCCTATCTCGAGATAGGCATCTGTCAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002028.3-424s21c1
Sequence:CCGGCGACAACTGACAGATGCCTATCTCGAGATAGGCATCTGTCAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002028.3-1398s21c1
Sequence:CCGGCACTACATACTTTCTACAGAACTCGAGTTCTGTAGAAAGTATGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002028.3-836s21c1
Sequence:CCGGGCACTGCTGAATGGATAGCAACTCGAGTTGCTATCCATTCAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002028.3-294s21c1
Sequence:CCGGCACGTCCATAGAACAGGCAAACTCGAGTTTGCCTGTTCTATGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145927
VALIDATED
FNTB MISSION shRNA Bacterial Glycerol Stock
farnesyltransferase, CAAX box, beta
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145927.1-824s1c1
Sequence:CCGGCCTCAAGAAGGAACGTTCTTTCTCGAGAAAGAACGTTCCTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145927.1-573s1c1
Sequence:CCGGCTTCAGTATTTGTACTCCCTACTCGAGTAGGGAGTACAAATACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145927.1-1645s1c1
Sequence:CCGGCCAATGCTGAAATGGAAGATACTCGAGTATCTTCCATTTCAGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145927.1-1241s1c1
Sequence:CCGGGTACAACATTGGACCTGAGAACTCGAGTTCTCAGGTCCAATGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145927.2-1241s21c1
Sequence:CCGGGTACAACATTGGACCTGAGAACTCGAGTTCTCAGGTCCAATGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145927.2-94s21c1
Sequence:CCGGTTTGGTCAGAACCGCTGTATACTCGAGTATACAGCGGTTCTGACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145927.2-824s21c1
Sequence:CCGGCCTCAAGAAGGAACGTTCTTTCTCGAGAAAGAACGTTCCTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145927.2-1645s21c1
Sequence:CCGGCCAATGCTGAAATGGAAGATACTCGAGTATCTTCCATTTCAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145927
VALIDATED
FNTB MISSION shRNA shRNA Plasmid DNA
farnesyltransferase, CAAX box, beta
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145927.1-824s1c1
Sequence:CCGGCCTCAAGAAGGAACGTTCTTTCTCGAGAAAGAACGTTCCTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145927.1-573s1c1
Sequence:CCGGCTTCAGTATTTGTACTCCCTACTCGAGTAGGGAGTACAAATACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145927.1-1645s1c1
Sequence:CCGGCCAATGCTGAAATGGAAGATACTCGAGTATCTTCCATTTCAGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145927.1-1241s1c1
Sequence:CCGGGTACAACATTGGACCTGAGAACTCGAGTTCTCAGGTCCAATGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145927.2-1241s21c1
Sequence:CCGGGTACAACATTGGACCTGAGAACTCGAGTTCTCAGGTCCAATGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145927.2-94s21c1
Sequence:CCGGTTTGGTCAGAACCGCTGTATACTCGAGTATACAGCGGTTCTGACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145927.2-824s21c1
Sequence:CCGGCCTCAAGAAGGAACGTTCTTTCTCGAGAAAGAACGTTCCTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145927.2-1645s21c1
Sequence:CCGGCCAATGCTGAAATGGAAGATACTCGAGTATCTTCCATTTCAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145927
VALIDATED
FNTB MISSION shRNA Lentiviral Transduction Particles
farnesyltransferase, CAAX box, beta
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145927.1-824s1c1
Sequence:CCGGCCTCAAGAAGGAACGTTCTTTCTCGAGAAAGAACGTTCCTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145927.1-573s1c1
Sequence:CCGGCTTCAGTATTTGTACTCCCTACTCGAGTAGGGAGTACAAATACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145927.1-1645s1c1
Sequence:CCGGCCAATGCTGAAATGGAAGATACTCGAGTATCTTCCATTTCAGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145927.1-1241s1c1
Sequence:CCGGGTACAACATTGGACCTGAGAACTCGAGTTCTCAGGTCCAATGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145927.2-1241s21c1
Sequence:CCGGGTACAACATTGGACCTGAGAACTCGAGTTCTCAGGTCCAATGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145927.2-94s21c1
Sequence:CCGGTTTGGTCAGAACCGCTGTATACTCGAGTATACAGCGGTTCTGACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145927.2-824s21c1
Sequence:CCGGCCTCAAGAAGGAACGTTCTTTCTCGAGAAAGAACGTTCCTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145927.2-1645s21c1
Sequence:CCGGCCAATGCTGAAATGGAAGATACTCGAGTATCTTCCATTTCAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks