EMAIL THIS PAGE TO A FRIEND

FOCAD

focadhesin

140 Gene Product Result for
Synonyms: KIAA1797
Gene ID:
Mouse(230393) focadhesin
Rat(313346) focadhesin
sheep(101103125) focadhesin
cow(506199) focadhesin
dog(481557) focadhesin
chicken(427233) focadhesin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017794 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017794 Rosetta Predictions human pricing
XM_001053590 Rosetta Predictions rat pricing
XM_233144 Rosetta Predictions rat pricing
NM_001081184 Rosetta Predictions mouse pricing
XM_001001702 Rosetta Predictions mouse pricing
XM_283973 Rosetta Predictions mouse pricing
XM_899409 Rosetta Predictions mouse pricing
XM_899415 Rosetta Predictions mouse pricing
XM_899419 Rosetta Predictions mouse pricing
XM_899421 Rosetta Predictions mouse pricing
XM_899424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218520 predicted 4602
2 SASI_Hs02_00350660 predicted 4689
3 SASI_Hs02_00350661 predicted 5853
4 SASI_Hs01_00218521 predicted 4320
5 SASI_Hs01_00218522 predicted 2716
6 SASI_Hs01_00218523 predicted 4870
7 SASI_Hs01_00218524 predicted 5243
8 SASI_Hs01_00218525 predicted 2313
9 SASI_Hs01_00218526 predicted 4746
10 SASI_Hs01_00218527 predicted 5707
11 SASI_Hs01_00218519 predicted 2182
12 SASI_Hs01_00218528 predicted 2883
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272890 predicted 1492
2 SASI_Rn02_00272891 predicted 2526
3 SASI_Rn02_00272892 predicted 3952
4 SASI_Rn02_00272893 predicted 4581
5 SASI_Rn02_00272894 predicted 1225
6 SASI_Rn02_00272895 predicted 3566
7 SASI_Rn02_00272896 predicted 4230
8 SASI_Rn02_00272897 predicted 1965
9 SASI_Rn02_00272898 predicted 5267
10 SASI_Rn02_00272899 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387450 predicted 1129
2 SASI_Rn02_00387451 predicted 2165
3 SASI_Rn02_00387452 predicted 3584
4 SASI_Rn02_00387453 predicted 4209
5 SASI_Rn02_00387454 predicted 853
6 SASI_Rn02_00387455 predicted 3198
7 SASI_Rn02_00387456 predicted 3859
8 SASI_Rn02_00387457 predicted 1597
9 SASI_Rn02_00387458 predicted 4900
10 SASI_Rn02_00387459 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296011 predicted 3289
2 SASI_Mm02_00296012 predicted 381
3 SASI_Mm02_00296013 predicted 2185
4 SASI_Mm02_00296014 predicted 4657
5 SASI_Mm02_00296015 predicted 443
6 SASI_Mm02_00296016 predicted 991
7 SASI_Mm02_00296017 predicted 3749
8 SASI_Mm02_00296018 predicted 5443
9 SASI_Mm02_00296019 predicted 1582
10 SASI_Mm02_00296020 predicted 4235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205812 predicted 3049
2 SASI_Mm01_00205813 predicted 4682
3 SASI_Mm01_00205814 predicted 4480
4 SASI_Mm01_00205815 predicted 409
5 SASI_Mm01_00205816 predicted 1949
6 SASI_Mm01_00205817 predicted 4425
7 SASI_Mm01_00205818 predicted 1016
8 SASI_Mm01_00205819 predicted 3507
9 SASI_Mm01_00205820 predicted 5204
10 SASI_Mm01_00205821 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239225 predicted 392
2 SASI_Mm01_00239226 predicted 2190
3 SASI_Mm01_00239227 predicted 4658
4 SASI_Mm01_00239228 predicted 999
5 SASI_Mm01_00239229 predicted 3750
6 SASI_Mm01_00239230 predicted 1451
7 SASI_Mm01_00239231 predicted 5443
8 SASI_Mm01_00239232 predicted 1310
9 SASI_Mm01_00239233 predicted 1588
10 SASI_Mm01_00239234 predicted 4242
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206429 predicted 396
2 SASI_Mm01_00206430 predicted 819
3 SASI_Mm01_00206431 predicted 1049
4 SASI_Mm01_00206432 predicted 584
5 SASI_Mm01_00206433 predicted 454
6 SASI_Mm01_00206434 predicted 1000
7 SASI_Mm01_00206435 predicted 367
8 SASI_Mm01_00206436 predicted 407
9 SASI_Mm01_00206437 predicted 898
10 SASI_Mm01_00206438 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205066 predicted 304
2 SASI_Mm01_00205067 predicted 414
3 SASI_Mm01_00205068 predicted 720
4 SASI_Mm01_00205069 predicted 708
5 SASI_Mm01_00205070 predicted 836
6 SASI_Mm01_00205071 predicted 389
7 SASI_Mm01_00205072 predicted 411
8 SASI_Mm01_00205073 predicted 729
9 SASI_Mm01_00205074 predicted 829
10 SASI_Mm01_00205075 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215992 predicted 5119
2 SASI_Mm01_00215993 predicted 4916
3 SASI_Mm01_00215994 predicted 5519
4 SASI_Mm01_00215995 predicted 3839
5 SASI_Mm01_00215996 predicted 4852
6 SASI_Mm01_00215997 predicted 3946
7 SASI_Mm01_00215998 predicted 5536
8 SASI_Mm01_00215999 predicted 4165
9 SASI_Mm01_00216000 predicted 5637
10 SASI_Mm01_00216001 predicted 4433
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234895 predicted 1465
2 SASI_Mm01_00234896 predicted 1269
3 SASI_Mm01_00234897 predicted 1883
4 SASI_Mm01_00234898 predicted 1869
5 SASI_Mm01_00234899 predicted 1202
6 SASI_Mm01_00234900 predicted 297
7 SASI_Mm01_00234901 predicted 1885
8 SASI_Mm01_00234902 predicted 513
9 SASI_Mm01_00234903 predicted 1991
10 SASI_Mm01_00234904 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265282 predicted 1211
2 SASI_Mm01_00265283 predicted 2847
3 SASI_Mm01_00265284 predicted 2644
4 SASI_Mm01_00265285 predicted 1574
5 SASI_Mm01_00265286 predicted 2582
6 SASI_Mm01_00265287 predicted 1678
7 SASI_Mm01_00265288 predicted 3270
8 SASI_Mm01_00265289 predicted 1896
9 SASI_Mm01_00265290 predicted 3365
10 SASI_Mm01_00265291 predicted 2154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017794
FOCAD MISSION shRNA Bacterial Glycerol Stock
focadhesin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017794.3-3046s21c1
Sequence:CCGGGCATACATGAATCGAGCTTATCTCGAGATAAGCTCGATTCATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017794.3-952s21c1
Sequence:CCGGGCCCTGCTGAAAGTCTTACTTCTCGAGAAGTAAGACTTTCAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017794.3-1589s21c1
Sequence:CCGGCCAGTATGTATGGTACAATATCTCGAGATATTGTACCATACATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017794.3-1858s21c1
Sequence:CCGGAGACCACTGGAACCTATATTACTCGAGTAATATAGGTTCCAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017794.2-5936s1c1
Sequence:CCGGGAGGAGTGCATTGCTTTAGTACTCGAGTACTAAAGCAATGCACTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017794.2-1589s1c1
Sequence:CCGGCCAGTATGTATGGTACAATATCTCGAGATATTGTACCATACATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017794.2-952s1c1
Sequence:CCGGGCCCTGCTGAAAGTCTTACTTCTCGAGAAGTAAGACTTTCAGCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017794.2-4986s1c1
Sequence:CCGGGCCAAATAAGATTCGGAGAAACTCGAGTTTCTCCGAATCTTATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017794
FOCAD MISSION shRNA shRNA Plasmid DNA
focadhesin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017794.3-3046s21c1
Sequence:CCGGGCATACATGAATCGAGCTTATCTCGAGATAAGCTCGATTCATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017794.3-952s21c1
Sequence:CCGGGCCCTGCTGAAAGTCTTACTTCTCGAGAAGTAAGACTTTCAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017794.3-1589s21c1
Sequence:CCGGCCAGTATGTATGGTACAATATCTCGAGATATTGTACCATACATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017794.3-1858s21c1
Sequence:CCGGAGACCACTGGAACCTATATTACTCGAGTAATATAGGTTCCAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017794.2-5936s1c1
Sequence:CCGGGAGGAGTGCATTGCTTTAGTACTCGAGTACTAAAGCAATGCACTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017794.2-1589s1c1
Sequence:CCGGCCAGTATGTATGGTACAATATCTCGAGATATTGTACCATACATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017794.2-952s1c1
Sequence:CCGGGCCCTGCTGAAAGTCTTACTTCTCGAGAAGTAAGACTTTCAGCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017794.2-4986s1c1
Sequence:CCGGGCCAAATAAGATTCGGAGAAACTCGAGTTTCTCCGAATCTTATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017794
FOCAD MISSION shRNA Lentiviral Transduction Particles
focadhesin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017794.3-3046s21c1
Sequence:CCGGGCATACATGAATCGAGCTTATCTCGAGATAAGCTCGATTCATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017794.3-952s21c1
Sequence:CCGGGCCCTGCTGAAAGTCTTACTTCTCGAGAAGTAAGACTTTCAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017794.3-1589s21c1
Sequence:CCGGCCAGTATGTATGGTACAATATCTCGAGATATTGTACCATACATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017794.3-1858s21c1
Sequence:CCGGAGACCACTGGAACCTATATTACTCGAGTAATATAGGTTCCAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017794.2-5936s1c1
Sequence:CCGGGAGGAGTGCATTGCTTTAGTACTCGAGTACTAAAGCAATGCACTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017794.2-1589s1c1
Sequence:CCGGCCAGTATGTATGGTACAATATCTCGAGATATTGTACCATACATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017794.2-952s1c1
Sequence:CCGGGCCCTGCTGAAAGTCTTACTTCTCGAGAAGTAAGACTTTCAGCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017794.2-4986s1c1
Sequence:CCGGGCCAAATAAGATTCGGAGAAACTCGAGTTTCTCCGAATCTTATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081184
VALIDATED
FOCAD MISSION shRNA Bacterial Glycerol Stock
focadhesin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-4693s21c1
Sequence:CCGGCCAAATAGGATTCGGAGAAATCTCGAGATTTCTCCGAATCCTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-5033s21c1
Sequence:CCGGCTTACCAGTCAGCACCTATACCTCGAGGTATAGGTGCTGACTGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-1841s21c1
Sequence:CCGGCTGCGTCCATCAGAGATATATCTCGAGATATATCTCTGATGGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-4122s21c1
Sequence:CCGGTCCTACTGACTACAGCTATTTCTCGAGAAATAGCTGTAGTCAGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-5541s21c1
Sequence:CCGGGACTGCTATCTGAGATCTATGCTCGAGCATAGATCTCAGATAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081184
VALIDATED
FOCAD MISSION shRNA shRNA Plasmid DNA
focadhesin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-4693s21c1
Sequence:CCGGCCAAATAGGATTCGGAGAAATCTCGAGATTTCTCCGAATCCTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-5033s21c1
Sequence:CCGGCTTACCAGTCAGCACCTATACCTCGAGGTATAGGTGCTGACTGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-1841s21c1
Sequence:CCGGCTGCGTCCATCAGAGATATATCTCGAGATATATCTCTGATGGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-4122s21c1
Sequence:CCGGTCCTACTGACTACAGCTATTTCTCGAGAAATAGCTGTAGTCAGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-5541s21c1
Sequence:CCGGGACTGCTATCTGAGATCTATGCTCGAGCATAGATCTCAGATAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081184
VALIDATED
FOCAD MISSION shRNA Lentiviral Transduction Particles
focadhesin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-4693s21c1
Sequence:CCGGCCAAATAGGATTCGGAGAAATCTCGAGATTTCTCCGAATCCTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-5033s21c1
Sequence:CCGGCTTACCAGTCAGCACCTATACCTCGAGGTATAGGTGCTGACTGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-1841s21c1
Sequence:CCGGCTGCGTCCATCAGAGATATATCTCGAGATATATCTCTGATGGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-4122s21c1
Sequence:CCGGTCCTACTGACTACAGCTATTTCTCGAGAAATAGCTGTAGTCAGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081184.1-5541s21c1
Sequence:CCGGGACTGCTATCTGAGATCTATGCTCGAGCATAGATCTCAGATAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks