EMAIL THIS PAGE TO A FRIEND

FOLH1

folate hydrolase (prostate-specific membrane antigen) 1

76 Gene Product Result for
Synonyms: FGCP FOLH GCP2 GCPII NAALAD1 NAALAdase PSM PSMA mGCP
Gene ID:
Human(2346) Summary: This gene encodes a type II transmembrane glycoprotein belonging to the M28 peptidase family. The protein acts as a glutamate carboxypeptidase on different alternative substrates, including the nutrient folate and the neuropeptide N-acetyl-l-aspartyl-l-glutamate and is expressed in a number of tissues such as prostate, central and peripheral nervous system and kidney. A mutation in this gene may be associated with impaired intestinal absorption of dietary folates, resulting in low blood folate levels and consequent hyperhomocysteinemia. Expression of this protein in the brain may be involved in a number of pathological conditions associated with glutamate excitotoxicity. In the prostate the protein is up-regulated in cancerous cells and is used as an effective diagnostic and prognostic indicator of prostate cancer. This gene likely arose from a duplication event of a nearby chromosomal region. Alternative splicing gives rise to multiple transcript variants encoding several different isoforms. [provided by RefSeq, Jul 2010]
Mouse(53320) folate hydrolase 1
Rat(85309) folate hydrolase 1
chicken(419011) folate hydrolase (prostate-specific membrane antigen) 1
dog(476775) folate hydrolase (prostate-specific membrane antigen) 1
cow(505865) folate hydrolase (prostate-specific membrane antigen) 1
domestic guinea pig(100712916) folate hydrolase (prostate-specific membrane antigen) 1
naked mole-rat(101725016) folate hydrolase (prostate-specific membrane antigen) 1
Domestic Rabbit(100358060) folate hydrolase (prostate-specific membrane antigen) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
514101 1,2,4-Butanetricarboxylic acid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004476 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU017161 MISSION® esiRNA esiRNA targeting mouse Folh1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014986 Rosetta Predictions human pricing
NM_004476 Rosetta Predictions human pricing
NM_057185 Rosetta Predictions rat pricing
NM_016770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147412 predicted 1908
2 SASI_Hs01_00147413 predicted 723
3 SASI_Hs01_00147414 predicted 398
4 SASI_Hs02_00306614 predicted 723
5 SASI_Hs01_00147415 predicted 982
6 SASI_Hs01_00147416 predicted 777
7 SASI_Hs02_00306615 predicted 398
8 SASI_Hs01_00147419 predicted 2001
9 SASI_Hs01_00147420 predicted 854
10 SASI_Hs01_00147421 predicted 1238
11 SASI_Hs01_00147417 predicted 1067
12 SASI_Hs01_00147418 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234956 predicted 1904
2 SASI_Hs01_00234957 predicted 725
3 SASI_Hs01_00234958 predicted 400
4 SASI_Hs02_00337688 predicted 715
5 SASI_Hs01_00234959 predicted 981
6 SASI_Hs01_00234960 predicted 771
7 SASI_Hs02_00337689 predicted 397
8 SASI_Hs01_00234963 predicted 2006
9 SASI_Hs01_00234964 predicted 861
10 SASI_Hs01_00234965 predicted 1237
11 SASI_Hs01_00234961 predicted 1066
12 SASI_Hs01_00234962 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034473 predicted 196
2 SASI_Rn01_00034474 predicted 1339
3 SASI_Rn02_00267135 predicted 536
4 SASI_Rn01_00034475 predicted 637
5 SASI_Rn01_00034476 predicted 1899
6 SASI_Rn01_00034477 predicted 1851
7 SASI_Rn01_00034478 predicted 393
8 SASI_Rn01_00034479 predicted 677
9 SASI_Rn01_00034480 predicted 1728
10 SASI_Rn02_00267136 predicted 509
11 SASI_Rn01_00034472 predicted 2255
12 SASI_Rn01_00034481 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056787 predicted 441
2 SASI_Mm02_00323535 predicted 1489
3 SASI_Mm01_00056789 predicted 2004
4 SASI_Mm01_00056791 predicted 205
5 SASI_Mm01_00056793 predicted 1858
6 SASI_Mm01_00056794 predicted 536
7 SASI_Mm01_00056795 predicted 1350
8 SASI_Mm01_00056796 predicted 2069
9 SASI_Mm02_00323536 predicted 1939
10 SASI_Mm02_00323537 predicted 680
11 SASI_Mm01_00056788 predicted 1936
12 SASI_Mm01_00056790 predicted 682
13 SASI_Mm01_00056792 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004476
FOLH1 MISSION shRNA Bacterial Glycerol Stock
folate hydrolase (prostate-specific membrane antigen) 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-799s1c1
Sequence:CCGGGCACGAACTGAAGACTTCTTTCTCGAGAAAGAAGTCTTCAGTTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-618s1c1
Sequence:CCGGCCCAAATAAGACTCATCCCAACTCGAGTTGGGATGAGTCTTATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-1909s1c1
Sequence:CCGGCCACTGTATCACAGTGTCTATCTCGAGATAGACACTGTGATACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-398s1c1
Sequence:CCGGCCAATGAAGCTACTAACATTACTCGAGTAATGTTAGTAGCTTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-634s1c1
Sequence:CCGGCCCAACTACATCTCAATAATTCTCGAGAATTATTGAGATGTAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004476
FOLH1 MISSION shRNA shRNA Plasmid DNA
folate hydrolase (prostate-specific membrane antigen) 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-799s1c1
Sequence:CCGGGCACGAACTGAAGACTTCTTTCTCGAGAAAGAAGTCTTCAGTTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-618s1c1
Sequence:CCGGCCCAAATAAGACTCATCCCAACTCGAGTTGGGATGAGTCTTATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-1909s1c1
Sequence:CCGGCCACTGTATCACAGTGTCTATCTCGAGATAGACACTGTGATACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-398s1c1
Sequence:CCGGCCAATGAAGCTACTAACATTACTCGAGTAATGTTAGTAGCTTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-634s1c1
Sequence:CCGGCCCAACTACATCTCAATAATTCTCGAGAATTATTGAGATGTAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004476
FOLH1 MISSION shRNA Lentiviral Transduction Particles
folate hydrolase (prostate-specific membrane antigen) 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-799s1c1
Sequence:CCGGGCACGAACTGAAGACTTCTTTCTCGAGAAAGAAGTCTTCAGTTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-618s1c1
Sequence:CCGGCCCAAATAAGACTCATCCCAACTCGAGTTGGGATGAGTCTTATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-1909s1c1
Sequence:CCGGCCACTGTATCACAGTGTCTATCTCGAGATAGACACTGTGATACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-398s1c1
Sequence:CCGGCCAATGAAGCTACTAACATTACTCGAGTAATGTTAGTAGCTTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004476.1-634s1c1
Sequence:CCGGCCCAACTACATCTCAATAATTCTCGAGAATTATTGAGATGTAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016770
FOLH1 MISSION shRNA Bacterial Glycerol Stock
folate hydrolase (prostate-specific membrane antigen) 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000032194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016770.2-2095s1c1
Sequence:CCGGCGTGCATTCATTGATCCTTTACTCGAGTAAAGGATCAATGAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016770.2-264s1c1
Sequence:CCGGGCATGAATTGAAGGCTGAGAACTCGAGTTCTCAGCCTTCAATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016770.2-389s1c1
Sequence:CCGGGCCTGGATTTGGTTGAGTTATCTCGAGATAACTCAACCAAATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016770.2-1180s1c1
Sequence:CCGGCCAGACAGATATGTTATTCTTCTCGAGAAGAATAACATATCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016770
FOLH1 MISSION shRNA shRNA Plasmid DNA
folate hydrolase (prostate-specific membrane antigen) 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000032194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016770.2-2095s1c1
Sequence:CCGGCGTGCATTCATTGATCCTTTACTCGAGTAAAGGATCAATGAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016770.2-264s1c1
Sequence:CCGGGCATGAATTGAAGGCTGAGAACTCGAGTTCTCAGCCTTCAATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016770.2-389s1c1
Sequence:CCGGGCCTGGATTTGGTTGAGTTATCTCGAGATAACTCAACCAAATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016770.2-1180s1c1
Sequence:CCGGCCAGACAGATATGTTATTCTTCTCGAGAAGAATAACATATCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016770
FOLH1 MISSION shRNA Lentiviral Transduction Particles
folate hydrolase (prostate-specific membrane antigen) 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000032194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016770.2-2095s1c1
Sequence:CCGGCGTGCATTCATTGATCCTTTACTCGAGTAAAGGATCAATGAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016770.2-264s1c1
Sequence:CCGGGCATGAATTGAAGGCTGAGAACTCGAGTTCTCAGCCTTCAATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016770.2-389s1c1
Sequence:CCGGGCCTGGATTTGGTTGAGTTATCTCGAGATAACTCAACCAAATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016770.2-1180s1c1
Sequence:CCGGCCAGACAGATATGTTATTCTTCTCGAGAAGAATAACATATCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks