EMAIL THIS PAGE TO A FRIEND

FOLH1B

folate hydrolase 1B

21 Gene Product Result for
Synonyms: FOLH2 FOLHP GCP3 GCPIII PSM PSMA-LIKE PSMAL
UniProtKB ID: Q9HBA9
Gene ID:
Horse(100060132) folate hydrolase 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153696 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153696 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153696 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153696 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182222 predicted 1250
2 SASI_Hs01_00182223 predicted 1432
3 SASI_Hs01_00182224 predicted 1596
4 SASI_Hs01_00182225 predicted 652
5 SASI_Hs01_00182227 predicted 1585
6 SASI_Hs01_00182228 predicted 986
7 SASI_Hs01_00182229 predicted 1348
8 SASI_Hs01_00182230 predicted 1069
9 SASI_Hs02_00367409 predicted 563
10 SASI_Hs01_00182231 predicted 580
11 SASI_Hs01_00182226 predicted 1469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153696
FOLH1B MISSION shRNA Bacterial Glycerol Stock
folate hydrolase 1B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153696.2-593s1c1
Sequence:CCGGCCTGGCTTTACTGGAAACTTTCTCGAGAAAGTTTCCAGTAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153696.2-645s1c1
Sequence:CCGGCTACCAATGAAGTGACGAGAACTCGAGTTCTCGTCACTTCATTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153696.2-1392s1c1
Sequence:CCGGGTCGAGATTATGCTGTAGTTTCTCGAGAAACTACAGCATAATCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-1338s21c1
Sequence:CCGGTTCGAGGAGGGATGGTGTTTGCTCGAGCAAACACCATCCCTCCTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-1619s21c1
Sequence:CCGGAGAGCATTTATTGATCCATTACTCGAGTAATGGATCAATAAATGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-567s21c1
Sequence:CCGGGTCTCAAAGTGTCCTACAATGCTCGAGCATTGTAGGACACTTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-1079s21c1
Sequence:CCGGCTTTATGAAAGTTGGACTAAACTCGAGTTTAGTCCAACTTTCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-1709s21c1
Sequence:CCGGGAGTCATTCCCAGGAATTTATCTCGAGATAAATTCCTGGGAATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153696
FOLH1B MISSION shRNA shRNA Plasmid DNA
folate hydrolase 1B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153696.2-593s1c1
Sequence:CCGGCCTGGCTTTACTGGAAACTTTCTCGAGAAAGTTTCCAGTAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153696.2-645s1c1
Sequence:CCGGCTACCAATGAAGTGACGAGAACTCGAGTTCTCGTCACTTCATTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153696.2-1392s1c1
Sequence:CCGGGTCGAGATTATGCTGTAGTTTCTCGAGAAACTACAGCATAATCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-1338s21c1
Sequence:CCGGTTCGAGGAGGGATGGTGTTTGCTCGAGCAAACACCATCCCTCCTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-1619s21c1
Sequence:CCGGAGAGCATTTATTGATCCATTACTCGAGTAATGGATCAATAAATGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-567s21c1
Sequence:CCGGGTCTCAAAGTGTCCTACAATGCTCGAGCATTGTAGGACACTTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-1079s21c1
Sequence:CCGGCTTTATGAAAGTTGGACTAAACTCGAGTTTAGTCCAACTTTCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-1709s21c1
Sequence:CCGGGAGTCATTCCCAGGAATTTATCTCGAGATAAATTCCTGGGAATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153696
FOLH1B MISSION shRNA Lentiviral Transduction Particles
folate hydrolase 1B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153696.2-593s1c1
Sequence:CCGGCCTGGCTTTACTGGAAACTTTCTCGAGAAAGTTTCCAGTAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153696.2-645s1c1
Sequence:CCGGCTACCAATGAAGTGACGAGAACTCGAGTTCTCGTCACTTCATTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153696.2-1392s1c1
Sequence:CCGGGTCGAGATTATGCTGTAGTTTCTCGAGAAACTACAGCATAATCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-1338s21c1
Sequence:CCGGTTCGAGGAGGGATGGTGTTTGCTCGAGCAAACACCATCCCTCCTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-1619s21c1
Sequence:CCGGAGAGCATTTATTGATCCATTACTCGAGTAATGGATCAATAAATGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-567s21c1
Sequence:CCGGGTCTCAAAGTGTCCTACAATGCTCGAGCATTGTAGGACACTTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-1079s21c1
Sequence:CCGGCTTTATGAAAGTTGGACTAAACTCGAGTTTAGTCCAACTTTCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153696.2-1709s21c1
Sequence:CCGGGAGTCATTCCCAGGAATTTATCTCGAGATAAATTCCTGGGAATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks