EMAIL THIS PAGE TO A FRIEND

FOLR1

folate receptor 1 (adult)

122 Gene Product Result for
Synonyms: FBP FOLR
UniProtKB ID: P15328, Q53EW2, Q6FGT8, Q6LC90, Q9UCT2
Gene ID:
Human(2348) Summary: The protein encoded by this gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(14275) folate receptor 1 (adult)
Rat(171049) folate receptor 1 (adult)
chicken(395638) folate receptor 1 (adult)
cow(516067) folate receptor 1 (adult)
cow(539750) folate receptor 1 (adult)
domestic cat(101084221) folate receptor 1 (adult)
dog(609612) folate receptor 1 (adult)
naked mole-rat(101699175) folate receptor 1 (adult)
domestic guinea pig(100725439) folate receptor 1 (adult)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0659 Human FOLR1 / Folate Receptor Alpha ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016731 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008034 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008034 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008034 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000802 Rosetta Predictions human pricing
NM_016724 Rosetta Predictions human pricing
NM_016725 Rosetta Predictions human pricing
NM_016729 Rosetta Predictions human pricing
NM_016730 Rosetta Predictions human pricing
NM_016731 Rosetta Predictions human pricing
NM_133527 Rosetta Predictions rat pricing
NM_008034 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226481 predicted 576
2 SASI_Hs01_00226483 predicted 581
3 SASI_Hs01_00226484 predicted 240
4 SASI_Hs01_00226485 predicted 247
5 SASI_Hs01_00226486 predicted 392
6 SASI_Hs01_00226487 predicted 498
7 SASI_Hs01_00226488 predicted 509
8 SASI_Hs02_00303257 predicted 436
9 SASI_Hs01_00226489 predicted 574
10 SASI_Hs02_00303258 predicted 248
11 SASI_Hs01_00226480 predicted 583
12 SASI_Hs01_00226482 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052139 predicted 688
2 SASI_Hs01_00052141 predicted 699
3 SASI_Hs01_00052142 predicted 349
4 SASI_Hs01_00052143 predicted 363
5 SASI_Hs01_00052144 predicted 504
6 SASI_Hs01_00052145 predicted 614
7 SASI_Hs01_00052146 predicted 621
8 SASI_Hs02_00349849 predicted 552
9 SASI_Hs01_00052147 predicted 688
10 SASI_Hs02_00349850 predicted 361
11 SASI_Hs01_00052138 predicted 694
12 SASI_Hs01_00052140 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098878 predicted 760
2 SASI_Hs01_00098880 predicted 766
3 SASI_Hs01_00098881 predicted 424
4 SASI_Hs01_00098882 predicted 434
5 SASI_Hs01_00098883 predicted 573
6 SASI_Hs01_00098884 predicted 687
7 SASI_Hs01_00098885 predicted 691
8 SASI_Hs02_00349851 predicted 625
9 SASI_Hs01_00098886 predicted 764
10 SASI_Hs02_00349852 predicted 437
11 SASI_Hs01_00098877 predicted 768
12 SASI_Hs01_00098879 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222908 predicted 593
2 SASI_Hs01_00222910 predicted 604
3 SASI_Hs01_00222911 predicted 258
4 SASI_Hs01_00222912 predicted 270
5 SASI_Hs01_00222913 predicted 408
6 SASI_Hs01_00222914 predicted 523
7 SASI_Hs01_00222915 predicted 521
8 SASI_Hs02_00349853 predicted 459
9 SASI_Hs01_00222916 predicted 592
10 SASI_Hs02_00349854 predicted 264
11 SASI_Hs01_00222907 predicted 598
12 SASI_Hs01_00222909 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100292 predicted 980
2 SASI_Hs01_00100294 predicted 994
3 SASI_Hs01_00100295 predicted 654
4 SASI_Hs01_00100296 predicted 657
5 SASI_Hs01_00100297 predicted 801
6 SASI_Hs01_00100298 predicted 914
7 SASI_Hs01_00100299 predicted 914
8 SASI_Hs02_00349855 predicted 847
9 SASI_Hs01_00100300 predicted 983
10 SASI_Hs02_00349856 predicted 658
11 SASI_Hs01_00100291 predicted 995
12 SASI_Hs01_00100293 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115159 predicted 560
2 SASI_Hs01_00115161 predicted 568
3 SASI_Hs01_00115162 predicted 227
4 SASI_Hs01_00115163 predicted 236
5 SASI_Hs01_00115164 predicted 381
6 SASI_Hs01_00115165 predicted 481
7 SASI_Hs01_00115166 predicted 488
8 SASI_Hs02_00349857 predicted 425
9 SASI_Hs01_00115167 predicted 561
10 SASI_Hs02_00349858 predicted 237
11 SASI_Hs01_00115158 predicted 563
12 SASI_Hs01_00115160 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102651 predicted 298
2 SASI_Rn01_00102652 predicted 264
3 SASI_Rn01_00102653 predicted 392
4 SASI_Rn02_00267708 predicted 246
5 SASI_Rn01_00102654 predicted 278
6 SASI_Rn01_00102655 predicted 363
7 SASI_Rn01_00102656 predicted 319
8 SASI_Rn01_00102657 predicted 393
9 SASI_Rn01_00102658 predicted 272
10 SASI_Rn01_00102659 predicted 229
11 SASI_Rn01_00102660 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155073 predicted 619
2 SASI_Mm01_00155074 predicted 920
3 SASI_Mm01_00155075 predicted 638
4 SASI_Mm01_00155076 predicted 1043
5 SASI_Mm01_00155077 predicted 459
6 SASI_Mm01_00155078 predicted 835
7 SASI_Mm01_00155079 predicted 385
8 SASI_Mm01_00155080 predicted 516
9 SASI_Mm01_00155081 predicted 741
10 SASI_Mm02_00312991 predicted 1057
11 SASI_Mm01_00155082 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016731
FOLR1 MISSION shRNA Bacterial Glycerol Stock
folate receptor 1 (adult)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016731.2-490s21c1
Sequence:CCGGGAACTGGACTTCAGGGTTTAACTCGAGTTAAACCCTGAAGTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016731.2-291s21c1
Sequence:CCGGCTGCCTGCAAACGGCATTTCACTCGAGTGAAATGCCGTTTGCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-563s1c1
Sequence:CCGGCCCACTGTTCTGTGCAATGAACTCGAGTTCATTGCACAGAACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-250s1c1
Sequence:CCGGCCTATATAGATTCAACTGGAACTCGAGTTCCAGTTGAATCTATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-535s1c1
Sequence:CCGGCCAACCTTTCCATTTCTACTTCTCGAGAAGTAGAAATGGAAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-106s1c1
Sequence:CCGGGCTTCTCAATGTCTGCATGAACTCGAGTTCATGCAGACATTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-426s1c1
Sequence:CCGGGTGAGCAATGGTGGGAAGATTCTCGAGAATCTTCCCACCATTGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016731
FOLR1 MISSION shRNA shRNA Plasmid DNA
folate receptor 1 (adult)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016731.2-490s21c1
Sequence:CCGGGAACTGGACTTCAGGGTTTAACTCGAGTTAAACCCTGAAGTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016731.2-291s21c1
Sequence:CCGGCTGCCTGCAAACGGCATTTCACTCGAGTGAAATGCCGTTTGCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-563s1c1
Sequence:CCGGCCCACTGTTCTGTGCAATGAACTCGAGTTCATTGCACAGAACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-250s1c1
Sequence:CCGGCCTATATAGATTCAACTGGAACTCGAGTTCCAGTTGAATCTATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-535s1c1
Sequence:CCGGCCAACCTTTCCATTTCTACTTCTCGAGAAGTAGAAATGGAAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-106s1c1
Sequence:CCGGGCTTCTCAATGTCTGCATGAACTCGAGTTCATGCAGACATTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-426s1c1
Sequence:CCGGGTGAGCAATGGTGGGAAGATTCTCGAGAATCTTCCCACCATTGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016731
FOLR1 MISSION shRNA Lentiviral Transduction Particles
folate receptor 1 (adult)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016731.2-490s21c1
Sequence:CCGGGAACTGGACTTCAGGGTTTAACTCGAGTTAAACCCTGAAGTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016731.2-291s21c1
Sequence:CCGGCTGCCTGCAAACGGCATTTCACTCGAGTGAAATGCCGTTTGCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-563s1c1
Sequence:CCGGCCCACTGTTCTGTGCAATGAACTCGAGTTCATTGCACAGAACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-250s1c1
Sequence:CCGGCCTATATAGATTCAACTGGAACTCGAGTTCCAGTTGAATCTATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-535s1c1
Sequence:CCGGCCAACCTTTCCATTTCTACTTCTCGAGAAGTAGAAATGGAAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-106s1c1
Sequence:CCGGGCTTCTCAATGTCTGCATGAACTCGAGTTCATGCAGACATTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016731.2-426s1c1
Sequence:CCGGGTGAGCAATGGTGGGAAGATTCTCGAGAATCTTCCCACCATTGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008034
FOLR1 MISSION shRNA Bacterial Glycerol Stock
folate receptor 1 (adult)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-645s1c1
Sequence:CCGGGCGGAACTATGACATCGGAATCTCGAGATTCCGATGTCATAGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-593s1c1
Sequence:CCGGCAGGAAGCACATAAGGACATTCTCGAGAATGTCCTTATGTGCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-464s1c1
Sequence:CCGGGCCAGGACTGAACTTCTCAATCTCGAGATTGAGAAGTTCAGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-592s1c1
Sequence:CCGGCCAGGAAGCACATAAGGACATCTCGAGATGTCCTTATGTGCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-904s1c1
Sequence:CCGGCCATCCCTTCACCTTCTACTTCTCGAGAAGTAGAAGGTGAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008034
FOLR1 MISSION shRNA shRNA Plasmid DNA
folate receptor 1 (adult)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-645s1c1
Sequence:CCGGGCGGAACTATGACATCGGAATCTCGAGATTCCGATGTCATAGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-593s1c1
Sequence:CCGGCAGGAAGCACATAAGGACATTCTCGAGAATGTCCTTATGTGCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-464s1c1
Sequence:CCGGGCCAGGACTGAACTTCTCAATCTCGAGATTGAGAAGTTCAGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-592s1c1
Sequence:CCGGCCAGGAAGCACATAAGGACATCTCGAGATGTCCTTATGTGCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-904s1c1
Sequence:CCGGCCATCCCTTCACCTTCTACTTCTCGAGAAGTAGAAGGTGAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008034
FOLR1 MISSION shRNA Lentiviral Transduction Particles
folate receptor 1 (adult)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-645s1c1
Sequence:CCGGGCGGAACTATGACATCGGAATCTCGAGATTCCGATGTCATAGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-593s1c1
Sequence:CCGGCAGGAAGCACATAAGGACATTCTCGAGAATGTCCTTATGTGCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-464s1c1
Sequence:CCGGGCCAGGACTGAACTTCTCAATCTCGAGATTGAGAAGTTCAGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-592s1c1
Sequence:CCGGCCAGGAAGCACATAAGGACATCTCGAGATGTCCTTATGTGCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008034.2-904s1c1
Sequence:CCGGCCATCCCTTCACCTTCTACTTCTCGAGAAGTAGAAGGTGAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks