EMAIL THIS PAGE TO A FRIEND

FOLR2

folate receptor 2 (fetal)

80 Gene Product Result for
Synonyms: BETA-HFR FBP FBP/PL-1 FR-BETA FR-P3
UniProtKB ID: P14207
Gene ID:
Human(2350) Summary: The protein encoded by this gene is a member of the folate receptor (FOLR) family, and these genes exist in a cluster on chromosome 11. Members of this gene family have a high affinity for folic acid and for several reduced folic acid derivatives, and they mediate delivery of 5-methyltetrahydrofolate to the interior of cells. This protein has a 68% and 79% sequence homology with the FOLR1 and FOLR3 proteins, respectively. Although this protein was originally thought to be specific to placenta, it can also exist in other tissues, and it may play a role in the transport of methotrexate in synovial macrophages in rheumatoid arthritis patients. Multiple transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14276) folate receptor 2 (fetal)
Rat(293154) folate receptor 2 (fetal)
domestic cat(101095853) folate receptor 2 (fetal)
dog(476816) folate receptor 2 (fetal)
cow(507672) folate receptor 2 (fetal)
sheep(101121452) folate receptor 2 (fetal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
SRP6476 FOLR2 human recombinant, expressed in HEK 293 cells, ≥95% (SDS-PAGE) human pricing

ELISA

Product # Description Species Add to Cart
 
RAB1465 Human FOLR2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000803 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000803 Rosetta Predictions human pricing
NM_001113534 Rosetta Predictions human pricing
NM_001113535 Rosetta Predictions human pricing
NM_001113536 Rosetta Predictions human pricing
NM_001106283 Rosetta Predictions rat pricing
NM_008035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087678 predicted 541
2 SASI_Hs01_00087679 predicted 666
3 SASI_Hs01_00087681 predicted 616
4 SASI_Hs01_00087683 predicted 543
5 SASI_Hs02_00303259 predicted 631
6 SASI_Hs02_00303260 predicted 530
7 SASI_Hs02_00303261 predicted 548
8 SASI_Hs02_00303262 predicted 587
9 SASI_Hs01_00087685 predicted 994
10 SASI_Hs01_00087687 predicted 1020
11 SASI_Hs01_00087680 predicted 488
12 SASI_Hs01_00087682 predicted 280
13 SASI_Hs01_00087684 predicted 248
14 SASI_Hs01_00087686 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326021 predicted 534
2 SASI_Hs02_00326022 predicted 663
3 SASI_Hs02_00326023 predicted 618
4 SASI_Hs02_00326024 predicted 534
5 SASI_Hs02_00326025 predicted 626
6 SASI_Hs02_00326026 predicted 525
7 SASI_Hs02_00326027 predicted 548
8 SASI_Hs02_00326028 predicted 575
9 SASI_Hs02_00326029 predicted 980
10 SASI_Hs02_00326030 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326031 predicted 531
2 SASI_Hs02_00326032 predicted 661
3 SASI_Hs02_00326033 predicted 606
4 SASI_Hs02_00326034 predicted 525
5 SASI_Hs02_00326035 predicted 622
6 SASI_Hs02_00326036 predicted 512
7 SASI_Hs02_00326037 predicted 539
8 SASI_Hs02_00326038 predicted 575
9 SASI_Hs02_00326039 predicted 977
10 SASI_Hs02_00326040 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326041 predicted 526
2 SASI_Hs02_00326042 predicted 655
3 SASI_Hs02_00326043 predicted 602
4 SASI_Hs02_00326044 predicted 527
5 SASI_Hs02_00326045 predicted 613
6 SASI_Hs02_00326046 predicted 507
7 SASI_Hs02_00326047 predicted 531
8 SASI_Hs02_00326048 predicted 564
9 SASI_Hs02_00326049 predicted 971
10 SASI_Hs02_00326050 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217448 predicted 479
2 SASI_Rn02_00217449 predicted 639
3 SASI_Rn02_00217450 predicted 777
4 SASI_Rn02_00217451 predicted 956
5 SASI_Rn02_00217452 predicted 763
6 SASI_Rn02_00217453 predicted 575
7 SASI_Rn02_00217454 predicted 636
8 SASI_Rn02_00217455 predicted 479
9 SASI_Rn02_00217456 predicted 975
10 SASI_Rn02_00217457 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022466 predicted 629
2 SASI_Mm01_00022467 predicted 739
3 SASI_Mm01_00022468 predicted 906
4 SASI_Mm01_00022470 predicted 477
5 SASI_Mm01_00022472 predicted 270
6 SASI_Mm01_00022473 predicted 679
7 SASI_Mm01_00022474 predicted 691
8 SASI_Mm01_00022475 predicted 725
9 SASI_Mm02_00312992 predicted 530
10 SASI_Mm02_00312993 predicted 368
11 SASI_Mm01_00022469 predicted 777
12 SASI_Mm01_00022471 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008035
FOLR2 MISSION shRNA Bacterial Glycerol Stock
folate receptor 2 (fetal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008035.1-1041s1c1
Sequence:CCGGCCTCTCTAGATTTCTCCTCTACTCGAGTAGAGGAGAAATCTAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008035.1-530s1c1
Sequence:CCGGTGCCTGTAAGAGTCACTTCATCTCGAGATGAAGTGACTCTTACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008035.1-614s1c1
Sequence:CCGGGAGTTGGCGTAAAGAGCGTTTCTCGAGAAACGCTCTTTACGCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008035.1-403s1c1
Sequence:CCGGACAAGCTGCATGACCAGTGTACTCGAGTACACTGGTCATGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008035.1-740s1c1
Sequence:CCGGAGGCATTAACAAGTGCCCAAACTCGAGTTTGGGCACTTGTTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008035
FOLR2 MISSION shRNA shRNA Plasmid DNA
folate receptor 2 (fetal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008035.1-1041s1c1
Sequence:CCGGCCTCTCTAGATTTCTCCTCTACTCGAGTAGAGGAGAAATCTAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008035.1-530s1c1
Sequence:CCGGTGCCTGTAAGAGTCACTTCATCTCGAGATGAAGTGACTCTTACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008035.1-614s1c1
Sequence:CCGGGAGTTGGCGTAAAGAGCGTTTCTCGAGAAACGCTCTTTACGCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008035.1-403s1c1
Sequence:CCGGACAAGCTGCATGACCAGTGTACTCGAGTACACTGGTCATGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008035.1-740s1c1
Sequence:CCGGAGGCATTAACAAGTGCCCAAACTCGAGTTTGGGCACTTGTTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008035
FOLR2 MISSION shRNA Lentiviral Transduction Particles
folate receptor 2 (fetal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008035.1-1041s1c1
Sequence:CCGGCCTCTCTAGATTTCTCCTCTACTCGAGTAGAGGAGAAATCTAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008035.1-530s1c1
Sequence:CCGGTGCCTGTAAGAGTCACTTCATCTCGAGATGAAGTGACTCTTACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008035.1-614s1c1
Sequence:CCGGGAGTTGGCGTAAAGAGCGTTTCTCGAGAAACGCTCTTTACGCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008035.1-403s1c1
Sequence:CCGGACAAGCTGCATGACCAGTGTACTCGAGTACACTGGTCATGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008035.1-740s1c1
Sequence:CCGGAGGCATTAACAAGTGCCCAAACTCGAGTTTGGGCACTTGTTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000803
FOLR2 MISSION shRNA Bacterial Glycerol Stock
folate receptor 2 (fetal)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000803.2-230s1c1
Sequence:CCGGCTCCTCAATGTCTGTATGGATCTCGAGATCCATACAGACATTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000803.2-706s1c1
Sequence:CCGGCCTCTGGAGTCACTCATACAACTCGAGTTGTATGAGTGACTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000803.2-616s1c1
Sequence:CCGGCTGGACCTCAGGAGTTAACAACTCGAGTTGTTAACTCCTGAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000803.2-285s1c1
Sequence:CCGGACAAGCTGCATGACCAATGCACTCGAGTGCATTGGTCATGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000803.4-962s21c1
Sequence:CCGGACCTGCCCTCAGCTTGGATAACTCGAGTTATCCAAGCTGAGGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000803.4-213s21c1
Sequence:CCGGTCTGTGTAGCCACCATGTGCACTCGAGTGCACATGGTGGCTACACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000803.4-541s21c1
Sequence:CCGGCTTCCTGGATGTGCCCTTATGCTCGAGCATAAGGGCACATCCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000803
FOLR2 MISSION shRNA shRNA Plasmid DNA
folate receptor 2 (fetal)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000803.2-230s1c1
Sequence:CCGGCTCCTCAATGTCTGTATGGATCTCGAGATCCATACAGACATTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000803.2-706s1c1
Sequence:CCGGCCTCTGGAGTCACTCATACAACTCGAGTTGTATGAGTGACTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000803.2-616s1c1
Sequence:CCGGCTGGACCTCAGGAGTTAACAACTCGAGTTGTTAACTCCTGAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000803.2-285s1c1
Sequence:CCGGACAAGCTGCATGACCAATGCACTCGAGTGCATTGGTCATGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000803.4-962s21c1
Sequence:CCGGACCTGCCCTCAGCTTGGATAACTCGAGTTATCCAAGCTGAGGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000803.4-213s21c1
Sequence:CCGGTCTGTGTAGCCACCATGTGCACTCGAGTGCACATGGTGGCTACACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000803.4-541s21c1
Sequence:CCGGCTTCCTGGATGTGCCCTTATGCTCGAGCATAAGGGCACATCCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000803
FOLR2 MISSION shRNA Lentiviral Transduction Particles
folate receptor 2 (fetal)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000803.2-230s1c1
Sequence:CCGGCTCCTCAATGTCTGTATGGATCTCGAGATCCATACAGACATTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000803.2-706s1c1
Sequence:CCGGCCTCTGGAGTCACTCATACAACTCGAGTTGTATGAGTGACTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000803.2-616s1c1
Sequence:CCGGCTGGACCTCAGGAGTTAACAACTCGAGTTGTTAACTCCTGAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000803.2-285s1c1
Sequence:CCGGACAAGCTGCATGACCAATGCACTCGAGTGCATTGGTCATGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000803.4-962s21c1
Sequence:CCGGACCTGCCCTCAGCTTGGATAACTCGAGTTATCCAAGCTGAGGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000803.4-213s21c1
Sequence:CCGGTCTGTGTAGCCACCATGTGCACTCGAGTGCACATGGTGGCTACACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000803.4-541s21c1
Sequence:CCGGCTTCCTGGATGTGCCCTTATGCTCGAGCATAAGGGCACATCCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks