EMAIL THIS PAGE TO A FRIEND

FOLR3

folate receptor 3 (gamma)

Synonyms: FR-G FR-gamma gamma-hFR
Species: Human FOLR3(2352), naked mole-rat Folr3(101721569)
UniProtKB ID: P41439
Gene ID:
Human(2352) Summary: This gene encodes a member of the folate receptor (FOLR) family, members of which have a high affinity for folic acid and for several reduced folic acid derivatives, and mediate delivery of 5-methyltetrahydrofolate to the interior of cells. This gene includes two polymorphic variants; the shorter one has two base deletion in the CDS, resulting in a truncated polypeptide, compared to the longer one. Both protein products are constitutively secreted in hematopoietic tissues and are potential serum marker for certain hematopoietic malignancies. The longer protein has a 71% and 79% sequence homology with the FOLR1 and FOLR2 proteins, respectively. [provided by RefSeq, Jul 2008]
naked mole-rat(101721569) folate receptor 3 (gamma)
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1466 Human FOLR3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000804 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043641 MISSION® esiRNA esiRNA human FOLR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000804 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025577 predicted 514
2 SASI_Hs01_00025578 predicted 519
3 SASI_Hs01_00025579 predicted 525
4 SASI_Hs01_00025580 predicted 309
5 SASI_Hs01_00025581 predicted 516
6 SASI_Hs01_00025582 predicted 420
7 SASI_Hs01_00025583 predicted 343
8 SASI_Hs01_00025584 predicted 303
9 SASI_Hs01_00025585 predicted 813
10 SASI_Hs02_00303263 predicted 770
11 SASI_Hs01_00025586 predicted 812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000804
FOLR3 MISSION shRNA Bacterial Glycerol Stock
folate receptor 3 (gamma)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-422s21c1
Sequence:CCGGGCGCAAAGAGCGCATTCTGAACTCGAGTTCAGAATGCGCTCTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-764s21c1
Sequence:CCGGGTCTCGTGGGATTATTGATTCCTCGAGGAATCAATAATCCCACGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-534s21c1
Sequence:CCGGTGGACCTCAGGGATTAATGAGCTCGAGCTCATTAATCCCTGAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-358s21c1
Sequence:CCGGACAGCTGTCTCTATGAGTGCTCTCGAGAGCACTCATAGAGACAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-319s21c1
Sequence:CCGGGTAAGATGGAACCCACCTGCACTCGAGTGCAGGTGGGTTCCATCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-638s21c1
Sequence:CCGGCTTCAAGGTCAGCAACTATAGCTCGAGCTATAGTTGCTGACCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000804.2-305s1c1
Sequence:CCGGCTGGGATCACTGTGGTAAGATCTCGAGATCTTACCACAGTGATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000804.2-671s1c1
Sequence:CCGGCCGCTGCATCCAGATGTGGTTCTCGAGAACCACATCTGGATGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000804.2-408s1c1
Sequence:CCGGGTCAACCAGAGCTGGCGCAAACTCGAGTTTGCGCCAGCTCTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000804.2-152s1c1
Sequence:CCGGCAATGTCTGCATGAACGCCAACTCGAGTTGGCGTTCATGCAGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000804
FOLR3 MISSION shRNA shRNA Plasmid DNA
folate receptor 3 (gamma)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-422s21c1
Sequence:CCGGGCGCAAAGAGCGCATTCTGAACTCGAGTTCAGAATGCGCTCTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-764s21c1
Sequence:CCGGGTCTCGTGGGATTATTGATTCCTCGAGGAATCAATAATCCCACGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-534s21c1
Sequence:CCGGTGGACCTCAGGGATTAATGAGCTCGAGCTCATTAATCCCTGAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-358s21c1
Sequence:CCGGACAGCTGTCTCTATGAGTGCTCTCGAGAGCACTCATAGAGACAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-319s21c1
Sequence:CCGGGTAAGATGGAACCCACCTGCACTCGAGTGCAGGTGGGTTCCATCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-638s21c1
Sequence:CCGGCTTCAAGGTCAGCAACTATAGCTCGAGCTATAGTTGCTGACCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000804.2-305s1c1
Sequence:CCGGCTGGGATCACTGTGGTAAGATCTCGAGATCTTACCACAGTGATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000804.2-671s1c1
Sequence:CCGGCCGCTGCATCCAGATGTGGTTCTCGAGAACCACATCTGGATGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000804.2-408s1c1
Sequence:CCGGGTCAACCAGAGCTGGCGCAAACTCGAGTTTGCGCCAGCTCTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000804.2-152s1c1
Sequence:CCGGCAATGTCTGCATGAACGCCAACTCGAGTTGGCGTTCATGCAGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000804
FOLR3 MISSION shRNA Lentiviral Transduction Particles
folate receptor 3 (gamma)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-422s21c1
Sequence:CCGGGCGCAAAGAGCGCATTCTGAACTCGAGTTCAGAATGCGCTCTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-764s21c1
Sequence:CCGGGTCTCGTGGGATTATTGATTCCTCGAGGAATCAATAATCCCACGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-534s21c1
Sequence:CCGGTGGACCTCAGGGATTAATGAGCTCGAGCTCATTAATCCCTGAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-358s21c1
Sequence:CCGGACAGCTGTCTCTATGAGTGCTCTCGAGAGCACTCATAGAGACAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-319s21c1
Sequence:CCGGGTAAGATGGAACCCACCTGCACTCGAGTGCAGGTGGGTTCCATCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000804.2-638s21c1
Sequence:CCGGCTTCAAGGTCAGCAACTATAGCTCGAGCTATAGTTGCTGACCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000804.2-305s1c1
Sequence:CCGGCTGGGATCACTGTGGTAAGATCTCGAGATCTTACCACAGTGATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000804.2-671s1c1
Sequence:CCGGCCGCTGCATCCAGATGTGGTTCTCGAGAACCACATCTGGATGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000804.2-408s1c1
Sequence:CCGGGTCAACCAGAGCTGGCGCAAACTCGAGTTTGCGCCAGCTCTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000804.2-152s1c1
Sequence:CCGGCAATGTCTGCATGAACGCCAACTCGAGTTGGCGTTCATGCAGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks