EMAIL THIS PAGE TO A FRIEND

FOLR4

folate receptor 4, delta (putative)

64 Gene Product Result for
Synonyms: Folbp3
UniProtKB ID: A6ND01
Gene ID:
Mouse(64931) folate receptor 4 (delta)
Rat(690037) folate receptor 4 (delta)
domestic cat(101087423) folate receptor 4 (delta) homolog (mouse)
dog(607523) folate receptor 4 (delta) homolog (mouse)
naked mole-rat(101704741) folate receptor 4, delta (putative)
domestic guinea pig(100721419) folate receptor 4, delta (putative)
sheep(101118558) folate receptor 4 (delta) homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080486 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080486 Rosetta Predictions human pricing
XM_372428 Rosetta Predictions human pricing
XM_001072998 Rosetta Predictions rat pricing
NM_022888 Rosetta Predictions mouse pricing
NM_176807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315306 predicted 401
2 SASI_Hs02_00315307 predicted 342
3 SASI_Hs02_00315308 predicted 408
4 SASI_Hs02_00315309 predicted 205
5 SASI_Hs02_00315310 predicted 341
6 SASI_Hs02_00315311 predicted 495
7 SASI_Hs02_00315312 predicted 396
8 SASI_Hs02_00315313 predicted 219
9 SASI_Hs02_00315314 predicted 212
10 SASI_Hs02_00315315 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254999 predicted 407
2 SASI_Hs01_00255000 predicted 498
3 SASI_Hs01_00255001 predicted 414
4 SASI_Hs01_00255002 predicted 402
5 SASI_Hs01_00255003 predicted 208
6 SASI_Hs01_00255004 predicted 418
7 SASI_Hs01_00255005 predicted 397
8 SASI_Hs01_00255006 predicted 489
9 SASI_Hs01_00255007 predicted 269
10 SASI_Hs01_00255008 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341229 predicted 534
2 SASI_Rn02_00341230 predicted 349
3 SASI_Rn02_00341231 predicted 271
4 SASI_Rn02_00341232 predicted 486
5 SASI_Rn02_00341233 predicted 202
6 SASI_Rn02_00341234 predicted 271
7 SASI_Rn02_00341235 predicted 276
8 SASI_Rn02_00341236 predicted 246
9 SASI_Rn02_00341237 predicted 561
10 SASI_Rn02_00341238 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139767 predicted 443
2 SASI_Mm02_00326682 predicted 303
3 SASI_Mm02_00326683 predicted 307
4 SASI_Mm01_00139768 predicted 440
5 SASI_Mm01_00139769 predicted 448
6 SASI_Mm02_00326684 predicted 300
7 SASI_Mm01_00139770 predicted 430
8 SASI_Mm01_00139772 predicted 395
9 SASI_Mm01_00139773 predicted 439
10 SASI_Mm01_00139774 predicted 340
11 SASI_Mm01_00139771 predicted 409
12 SASI_Mm01_00139775 predicted 325
13 SASI_Mm01_00139776 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072996 predicted 445
2 SASI_Mm02_00346711 predicted 303
3 SASI_Mm02_00346712 predicted 313
4 SASI_Mm01_00072997 predicted 437
5 SASI_Mm01_00072998 predicted 447
6 SASI_Mm02_00346713 predicted 305
7 SASI_Mm01_00072999 predicted 434
8 SASI_Mm01_00073001 predicted 395
9 SASI_Mm01_00073002 predicted 436
10 SASI_Mm01_00073003 predicted 340
11 SASI_Mm01_00073000 predicted 334
12 SASI_Mm01_00073004 predicted 259
13 SASI_Mm01_00073005 predicted 331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176807
FOLR4 MISSION shRNA Bacterial Glycerol Stock
folate receptor 4, delta (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176807.2-730s1c1
Sequence:CCGGGCAACCCTGGATTGCAGATAACTCGAGTTATCTGCAATCCAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176807.2-257s1c1
Sequence:CCGGCATGAATTCCAAGCGCCACAACTCGAGTTGTGGCGCTTGGAATTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176807.2-586s1c1
Sequence:CCGGGCCACTCATCTTTGACTTGTACTCGAGTACAAGTCAAAGATGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176807.2-587s1c1
Sequence:CCGGCCACTCATCTTTGACTTGTAACTCGAGTTACAAGTCAAAGATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176807.2-583s1c1
Sequence:CCGGCCTGCCACTCATCTTTGACTTCTCGAGAAGTCAAAGATGAGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176807
FOLR4 MISSION shRNA shRNA Plasmid DNA
folate receptor 4, delta (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176807.2-730s1c1
Sequence:CCGGGCAACCCTGGATTGCAGATAACTCGAGTTATCTGCAATCCAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176807.2-257s1c1
Sequence:CCGGCATGAATTCCAAGCGCCACAACTCGAGTTGTGGCGCTTGGAATTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176807.2-586s1c1
Sequence:CCGGGCCACTCATCTTTGACTTGTACTCGAGTACAAGTCAAAGATGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176807.2-587s1c1
Sequence:CCGGCCACTCATCTTTGACTTGTAACTCGAGTTACAAGTCAAAGATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176807.2-583s1c1
Sequence:CCGGCCTGCCACTCATCTTTGACTTCTCGAGAAGTCAAAGATGAGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176807
FOLR4 MISSION shRNA Lentiviral Transduction Particles
folate receptor 4, delta (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176807.2-730s1c1
Sequence:CCGGGCAACCCTGGATTGCAGATAACTCGAGTTATCTGCAATCCAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176807.2-257s1c1
Sequence:CCGGCATGAATTCCAAGCGCCACAACTCGAGTTGTGGCGCTTGGAATTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176807.2-586s1c1
Sequence:CCGGGCCACTCATCTTTGACTTGTACTCGAGTACAAGTCAAAGATGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176807.2-587s1c1
Sequence:CCGGCCACTCATCTTTGACTTGTAACTCGAGTTACAAGTCAAAGATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176807.2-583s1c1
Sequence:CCGGCCTGCCACTCATCTTTGACTTCTCGAGAAGTCAAAGATGAGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080486
FOLR4 MISSION shRNA Bacterial Glycerol Stock
folate receptor 4, delta (putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-344s21c1
Sequence:CCGGAGGGAGAGCGAGTTGTGAATGCTCGAGCATTCACAACTCGCTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-272s21c1
Sequence:CCGGTCCAGGCTATCTGCTTCTATGCTCGAGCATAGAAGCAGATAGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-536s21c1
Sequence:CCGGGTGAGAAGACTTGGAGCAATTCTCGAGAATTGCTCCAAGTCTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-113s21c1
Sequence:CCGGGCCCAGAAGACAAGCTCTATGCTCGAGCATAGAGCTTGTCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-492s21c1
Sequence:CCGGGTGCCTCCCTTTCTCCCATTACTCGAGTAATGGGAGAAAGGGAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080486
FOLR4 MISSION shRNA shRNA Plasmid DNA
folate receptor 4, delta (putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-344s21c1
Sequence:CCGGAGGGAGAGCGAGTTGTGAATGCTCGAGCATTCACAACTCGCTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-272s21c1
Sequence:CCGGTCCAGGCTATCTGCTTCTATGCTCGAGCATAGAAGCAGATAGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-536s21c1
Sequence:CCGGGTGAGAAGACTTGGAGCAATTCTCGAGAATTGCTCCAAGTCTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-113s21c1
Sequence:CCGGGCCCAGAAGACAAGCTCTATGCTCGAGCATAGAGCTTGTCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-492s21c1
Sequence:CCGGGTGCCTCCCTTTCTCCCATTACTCGAGTAATGGGAGAAAGGGAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080486
FOLR4 MISSION shRNA Lentiviral Transduction Particles
folate receptor 4, delta (putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-344s21c1
Sequence:CCGGAGGGAGAGCGAGTTGTGAATGCTCGAGCATTCACAACTCGCTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-272s21c1
Sequence:CCGGTCCAGGCTATCTGCTTCTATGCTCGAGCATAGAAGCAGATAGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-536s21c1
Sequence:CCGGGTGAGAAGACTTGGAGCAATTCTCGAGAATTGCTCCAAGTCTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-113s21c1
Sequence:CCGGGCCCAGAAGACAAGCTCTATGCTCGAGCATAGAGCTTGTCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080486.1-492s21c1
Sequence:CCGGGTGCCTCCCTTTCTCCCATTACTCGAGTAATGGGAGAAAGGGAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks