EMAIL THIS PAGE TO A FRIEND

FOPNL

FGFR1OP N-terminal like

86 Gene Product Result for
Synonyms: C16orf63 FOR20 PHSECRG2
UniProtKB ID: Q96NB1
Gene ID:
Mouse(66086) Fgfr1op N-terminal like
Rat(360461) FGFR1OP N-terminal like
Zebrafish(567944) fgfr1op N-terminal like
chicken(416598) FGFR1OP N-terminal like
dog(100684094) FGFR1OP N-terminal like
cow(782821) FGFR1OP N-terminal like
domestic cat(101097445) FGFR1OP N-terminal like
sheep(101114664) FGFR1OP N-terminal like
domestic guinea pig(100734950) FGFR1OP N-terminal like
naked mole-rat(101722593) FGFR1OP N-terminal like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025345 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025345 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025345 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144600 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144600 Rosetta Predictions human pricing
NM_001108261 Rosetta Predictions rat pricing
NM_025345 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050034 predicted 294
2 SASI_Hs01_00050035 predicted 149
3 SASI_Hs01_00050036 predicted 480
4 SASI_Hs01_00050037 predicted 608
5 SASI_Hs01_00050038 predicted 258
6 SASI_Hs01_00050039 predicted 484
7 SASI_Hs02_00364399 predicted 159
8 SASI_Hs01_00050040 predicted 172
9 SASI_Hs01_00050041 predicted 353
10 SASI_Hs02_00364400 predicted 500
11 SASI_Hs01_00050042 predicted 463
12 SASI_Hs01_00050043 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236914 predicted 276
2 SASI_Rn02_00236915 predicted 214
3 SASI_Rn02_00236916 predicted 198
4 SASI_Rn02_00236917 predicted 336
5 SASI_Rn02_00236918 predicted 596
6 SASI_Rn02_00236919 predicted 223
7 SASI_Rn02_00236920 predicted 527
8 SASI_Rn02_00236921 predicted 411
9 SASI_Rn02_00236922 predicted 223
10 SASI_Rn02_00236923 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025345 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197433 predicted 579
2 SASI_Mm01_00197434 predicted 651
3 SASI_Mm01_00197435 predicted 320
4 SASI_Mm01_00197436 predicted 645
5 SASI_Mm01_00197437 predicted 300
6 SASI_Mm01_00197438 predicted 812
7 SASI_Mm01_00197439 predicted 547
8 SASI_Mm01_00197440 predicted 309
9 SASI_Mm01_00197441 predicted 290
10 SASI_Mm01_00197442 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025345
VALIDATED
FOPNL MISSION shRNA Bacterial Glycerol Stock
FGFR1OP N-terminal like
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025345.2-574s21c1
Sequence:CCGGGTGGAGTAACCGACGTATTATCTCGAGATAATACGTCGGTTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025345.2-149s21c1
Sequence:CCGGGTCTCATGAGAACCTTCTAATCTCGAGATTAGAAGGTTCTCATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025345.2-65s21c1
Sequence:CCGGGGGAGTGTTAGGACATTTAAACTCGAGTTTAAATGTCCTAACACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025345.2-174s21c1
Sequence:CCGGGAATTAATTAGGGAGTATTTGCTCGAGCAAATACTCCCTAATTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025345.2-272s21c1
Sequence:CCGGGTTTCTCATCCGTGAACTAAACTCGAGTTTAGTTCACGGATGAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025345.2-270s1c1
Sequence:CCGGCAGTTTCTCATCCGTGAACTACTCGAGTAGTTCACGGATGAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025345
VALIDATED
FOPNL MISSION shRNA shRNA Plasmid DNA
FGFR1OP N-terminal like
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025345.2-574s21c1
Sequence:CCGGGTGGAGTAACCGACGTATTATCTCGAGATAATACGTCGGTTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025345.2-149s21c1
Sequence:CCGGGTCTCATGAGAACCTTCTAATCTCGAGATTAGAAGGTTCTCATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025345.2-65s21c1
Sequence:CCGGGGGAGTGTTAGGACATTTAAACTCGAGTTTAAATGTCCTAACACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025345.2-174s21c1
Sequence:CCGGGAATTAATTAGGGAGTATTTGCTCGAGCAAATACTCCCTAATTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025345.2-272s21c1
Sequence:CCGGGTTTCTCATCCGTGAACTAAACTCGAGTTTAGTTCACGGATGAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025345.2-270s1c1
Sequence:CCGGCAGTTTCTCATCCGTGAACTACTCGAGTAGTTCACGGATGAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025345
VALIDATED
FOPNL MISSION shRNA Lentiviral Transduction Particles
FGFR1OP N-terminal like
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025345.2-574s21c1
Sequence:CCGGGTGGAGTAACCGACGTATTATCTCGAGATAATACGTCGGTTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025345.2-149s21c1
Sequence:CCGGGTCTCATGAGAACCTTCTAATCTCGAGATTAGAAGGTTCTCATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025345.2-65s21c1
Sequence:CCGGGGGAGTGTTAGGACATTTAAACTCGAGTTTAAATGTCCTAACACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025345.2-174s21c1
Sequence:CCGGGAATTAATTAGGGAGTATTTGCTCGAGCAAATACTCCCTAATTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025345.2-272s21c1
Sequence:CCGGGTTTCTCATCCGTGAACTAAACTCGAGTTTAGTTCACGGATGAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025345.2-270s1c1
Sequence:CCGGCAGTTTCTCATCCGTGAACTACTCGAGTAGTTCACGGATGAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144600
VALIDATED
FOPNL MISSION shRNA Bacterial Glycerol Stock
FGFR1OP N-terminal like
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144600.1-230s1c1
Sequence:CCGGGCAGAATCTGGTCAACCTGTACTCGAGTACAGGTTGACCAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144600.1-463s1c1
Sequence:CCGGCCTAAGAAAGGAGGAACAGAACTCGAGTTCTGTTCCTCCTTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144600.1-450s1c1
Sequence:CCGGCAATGGATGACCACCTAAGAACTCGAGTTCTTAGGTGGTCATCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144600.1-1067s1c1
Sequence:CCGGGCCCTTAAAGTTTGTAAGGAACTCGAGTTCCTTACAAACTTTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144600.1-613s1c1
Sequence:CCGGGCACCACTAATGTTTGTAGAACTCGAGTTCTACAAACATTAGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144600.1-1603s1c1
Sequence:CCGGGCACCTAAACACTGACAACATCTCGAGATGTTGTCAGTGTTTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144600
VALIDATED
FOPNL MISSION shRNA shRNA Plasmid DNA
FGFR1OP N-terminal like
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144600.1-230s1c1
Sequence:CCGGGCAGAATCTGGTCAACCTGTACTCGAGTACAGGTTGACCAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144600.1-463s1c1
Sequence:CCGGCCTAAGAAAGGAGGAACAGAACTCGAGTTCTGTTCCTCCTTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144600.1-450s1c1
Sequence:CCGGCAATGGATGACCACCTAAGAACTCGAGTTCTTAGGTGGTCATCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144600.1-1067s1c1
Sequence:CCGGGCCCTTAAAGTTTGTAAGGAACTCGAGTTCCTTACAAACTTTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144600.1-613s1c1
Sequence:CCGGGCACCACTAATGTTTGTAGAACTCGAGTTCTACAAACATTAGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144600.1-1603s1c1
Sequence:CCGGGCACCTAAACACTGACAACATCTCGAGATGTTGTCAGTGTTTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144600
VALIDATED
FOPNL MISSION shRNA Lentiviral Transduction Particles
FGFR1OP N-terminal like
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144600.1-230s1c1
Sequence:CCGGGCAGAATCTGGTCAACCTGTACTCGAGTACAGGTTGACCAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144600.1-463s1c1
Sequence:CCGGCCTAAGAAAGGAGGAACAGAACTCGAGTTCTGTTCCTCCTTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144600.1-450s1c1
Sequence:CCGGCAATGGATGACCACCTAAGAACTCGAGTTCTTAGGTGGTCATCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144600.1-1067s1c1
Sequence:CCGGGCCCTTAAAGTTTGTAAGGAACTCGAGTTCCTTACAAACTTTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144600.1-613s1c1
Sequence:CCGGGCACCACTAATGTTTGTAGAACTCGAGTTCTACAAACATTAGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144600.1-1603s1c1
Sequence:CCGGGCACCTAAACACTGACAACATCTCGAGATGTTGTCAGTGTTTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks