EMAIL THIS PAGE TO A FRIEND

FOS

FBJ murine osteosarcoma viral oncogene homolog

143 Gene Product Result for
Synonyms: AP-1 C-FOS p55
UniProtKB ID: P01100, P18849
Gene ID:
Human(2353) Summary: The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. In some cases, expression of the FOS gene has also been associated with apoptotic cell death. [provided by RefSeq, Jul 2008]
Mouse(14281) FBJ osteosarcoma oncogene
Rat(314322) FBJ osteosarcoma oncogene
Zebrafish(394198) v-fos FBJ murine osteosarcoma viral oncogene homolog
chicken(396512) FBJ murine osteosarcoma viral oncogene homolog
dog(490792) FBJ murine osteosarcoma viral oncogene homolog
cow(280795) FBJ murine osteosarcoma viral oncogene homolog
domestic cat(493935) FBJ murine osteosarcoma viral oncogene homolog
sheep(443218) FBJ murine osteosarcoma viral oncogene homolog
naked mole-rat(101718383) FBJ murine osteosarcoma viral oncogene homolog
domestic guinea pig(100713572) FBJ murine osteosarcoma viral oncogene homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW21144 Anti-c-Fos antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
F7799 Anti-c-Fos antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
F137 Anti-c-Fos antibody produced in rabbit IgG fraction of antiserum, lyophilized powder mouse
western blot pricing
HPA018531 Anti-C-FOS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1306144 ANTI-C-FOS(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, western blot pricing
SAB2100832 Anti-FOS (ab1) antibody produced in rabbit affinity isolated antibody bovine, mouse, canine, pig, human, rat
western blot pricing
SAB2100833 Anti-FOS (ab2) antibody produced in rabbit affinity isolated antibody pig, human, bovine, canine, rat, mouse
western blot pricing
SAB2502116 Anti-FOS antibody produced in goat affinity isolated antibody, buffered aqueous solution human, cat, bovine, pig, canine
ELISA, western blot pricing
AV100639 Anti-FOS antibody produced in rabbit IgG fraction of antiserum mouse, bovine, canine, human, pig, rat, sheep
western blot pricing
SAB2104185 Anti-FOS antibody produced in rabbit affinity isolated antibody pig, mouse, sheep, guinea pig, horse, bovine, rabbit, rat, canine, human
western blot pricing
SAB4500995 Anti-FOS antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4500993 Anti-FOS, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4500996 Anti-FOS, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4500994 Anti-FOS, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4500997 Anti-FOS, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504656 Anti-phospho-FOS (pSer32) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4503871 Anti-phospho-Fos (pSer362) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301503 Anti-phospho-Fos (pSer362) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4504663 Anti-phospho-FOS (pThr232) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301323 Anti-phospho-FOS (pThr232) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB5300463 Monoclonal Anti-FOS antibody produced in mouse clone 2G2, ascites fluid human
ELISA, flow cytometry, immunohistochemistry, western blot pricing
SAB1402201 Monoclonal Anti-FOS antibody produced in mouse clone 2D11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010234 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010234 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010234 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005252 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005252 Rosetta Predictions human pricing
NM_022197 Rosetta Predictions rat pricing
NM_010234 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184572 predicted 282
2 SASI_Hs01_00184573 predicted 1632
3 SASI_Hs01_00184574 predicted 1652
4 SASI_Hs01_00184575 predicted 1150
5 SASI_Hs01_00184576 predicted 1730
6 SASI_Hs01_00184577 predicted 635
7 SASI_Hs01_00184578 predicted 1024
8 SASI_Hs01_00184579 predicted 631
9 SASI_Hs01_00184580 predicted 1412
10 SASI_Hs01_00184581 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053944 predicted 690
2 SASI_Rn01_00053945 predicted 644
3 SASI_Rn01_00053946 predicted 950
4 SASI_Rn01_00053949 predicted 274
5 SASI_Rn01_00053950 predicted 772
6 SASI_Rn02_00262947 predicted 847
7 SASI_Rn01_00053951 predicted 1025
8 SASI_Rn01_00053952 predicted 957
9 SASI_Rn01_00053953 predicted 636
10 SASI_Rn02_00262948 predicted 933
11 SASI_Rn01_00053947 predicted 1731
12 SASI_Rn01_00053948 predicted 1735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192758 predicted 551
2 SASI_Mm01_00192759 predicted 622
3 SASI_Mm01_00192760 predicted 935
4 SASI_Mm02_00318094 predicted 682
5 SASI_Mm01_00192761 predicted 945
6 SASI_Mm01_00192762 predicted 929
7 SASI_Mm01_00192763 predicted 458
8 SASI_Mm01_00192764 predicted 620
9 SASI_Mm01_00192766 predicted 516
10 SASI_Mm01_00192767 predicted 1139
11 SASI_Mm01_00192765 predicted 1213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010234
VALIDATED
FOS MISSION shRNA Bacterial Glycerol Stock
FBJ murine osteosarcoma viral oncogene homolog
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010234.2-266s1c1
Sequence:CCGGCCTGTCAACACACAGGACTTTCTCGAGAAAGTCCTGTGTGTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010234.2-638s1c1
Sequence:CCGGGCGGAGACAGATCAACTTGAACTCGAGTTCAAGTTGATCTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010234.2-300s1c1
Sequence:CCGGCCGTCTCTAGTGCCAACTTTACTCGAGTAAAGTTGGCACTAGAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010234.2-565s1c1
Sequence:CCGGCCGAAGGGAACGGAATAAGATCTCGAGATCTTATTCCGTTCCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010234.2-1141s1c1
Sequence:CCGGCACTACTTACACGTCTTCCTTCTCGAGAAGGAAGACGTGTAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010234.2-1394s21c1
Sequence:CCGGGACCTTACCTGTTCGTGAAACCTCGAGGTTTCACGAACAGGTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010234.2-301s21c1
Sequence:CCGGCGTCTCTAGTGCCAACTTTATCTCGAGATAAAGTTGGCACTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010234.2-1737s21c1
Sequence:CCGGCAATTAGAAACGACCAATATTCTCGAGAATATTGGTCGTTTCTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010234.2-1129s21c1
Sequence:CCGGTACTCCGGGCTGCACTACTTACTCGAGTAAGTAGTGCAGCCCGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010234.2-669s21c1
Sequence:CCGGCTGCGTTGCAGACTGAGATTGCTCGAGCAATCTCAGTCTGCAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010234.2-563s21c1
Sequence:CCGGATCCGAAGGGAACGGAATAAGCTCGAGCTTATTCCGTTCCCTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010234.2-638s21c1
Sequence:CCGGGCGGAGACAGATCAACTTGAACTCGAGTTCAAGTTGATCTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010234
VALIDATED
FOS MISSION shRNA shRNA Plasmid DNA
FBJ murine osteosarcoma viral oncogene homolog
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010234.2-266s1c1
Sequence:CCGGCCTGTCAACACACAGGACTTTCTCGAGAAAGTCCTGTGTGTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010234.2-638s1c1
Sequence:CCGGGCGGAGACAGATCAACTTGAACTCGAGTTCAAGTTGATCTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010234.2-300s1c1
Sequence:CCGGCCGTCTCTAGTGCCAACTTTACTCGAGTAAAGTTGGCACTAGAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010234.2-565s1c1
Sequence:CCGGCCGAAGGGAACGGAATAAGATCTCGAGATCTTATTCCGTTCCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010234.2-1141s1c1
Sequence:CCGGCACTACTTACACGTCTTCCTTCTCGAGAAGGAAGACGTGTAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010234.2-1394s21c1
Sequence:CCGGGACCTTACCTGTTCGTGAAACCTCGAGGTTTCACGAACAGGTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010234.2-301s21c1
Sequence:CCGGCGTCTCTAGTGCCAACTTTATCTCGAGATAAAGTTGGCACTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010234.2-1737s21c1
Sequence:CCGGCAATTAGAAACGACCAATATTCTCGAGAATATTGGTCGTTTCTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010234.2-1129s21c1
Sequence:CCGGTACTCCGGGCTGCACTACTTACTCGAGTAAGTAGTGCAGCCCGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010234.2-669s21c1
Sequence:CCGGCTGCGTTGCAGACTGAGATTGCTCGAGCAATCTCAGTCTGCAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010234.2-563s21c1
Sequence:CCGGATCCGAAGGGAACGGAATAAGCTCGAGCTTATTCCGTTCCCTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010234.2-638s21c1
Sequence:CCGGGCGGAGACAGATCAACTTGAACTCGAGTTCAAGTTGATCTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010234
VALIDATED
FOS MISSION shRNA Lentiviral Transduction Particles
FBJ murine osteosarcoma viral oncogene homolog
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010234.2-266s1c1
Sequence:CCGGCCTGTCAACACACAGGACTTTCTCGAGAAAGTCCTGTGTGTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010234.2-638s1c1
Sequence:CCGGGCGGAGACAGATCAACTTGAACTCGAGTTCAAGTTGATCTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010234.2-300s1c1
Sequence:CCGGCCGTCTCTAGTGCCAACTTTACTCGAGTAAAGTTGGCACTAGAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010234.2-565s1c1
Sequence:CCGGCCGAAGGGAACGGAATAAGATCTCGAGATCTTATTCCGTTCCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010234.2-1141s1c1
Sequence:CCGGCACTACTTACACGTCTTCCTTCTCGAGAAGGAAGACGTGTAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010234.2-1394s21c1
Sequence:CCGGGACCTTACCTGTTCGTGAAACCTCGAGGTTTCACGAACAGGTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010234.2-301s21c1
Sequence:CCGGCGTCTCTAGTGCCAACTTTATCTCGAGATAAAGTTGGCACTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010234.2-1737s21c1
Sequence:CCGGCAATTAGAAACGACCAATATTCTCGAGAATATTGGTCGTTTCTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010234.2-1129s21c1
Sequence:CCGGTACTCCGGGCTGCACTACTTACTCGAGTAAGTAGTGCAGCCCGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010234.2-669s21c1
Sequence:CCGGCTGCGTTGCAGACTGAGATTGCTCGAGCAATCTCAGTCTGCAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010234.2-563s21c1
Sequence:CCGGATCCGAAGGGAACGGAATAAGCTCGAGCTTATTCCGTTCCCTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010234.2-638s21c1
Sequence:CCGGGCGGAGACAGATCAACTTGAACTCGAGTTCAAGTTGATCTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005252
VALIDATED
FOS MISSION shRNA Bacterial Glycerol Stock
FBJ murine osteosarcoma viral oncogene homolog
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005252.2-654s1c1
Sequence:CCGGGCGGAGACAGACCAACTAGAACTCGAGTTCTAGTTGGTCTGTCTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005252.2-540s1c1
Sequence:CCGGGTGGAACAGTTATCTCCAGAACTCGAGTTCTGGAGATAACTGTTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005252.2-1157s1c1
Sequence:CCGGCACTGCTTACACGTCTTCCTTCTCGAGAAGGAAGACGTGTAAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005252.2-1551s1c1
Sequence:CCGGGCTGGTAGTTAGTAGCATGTTCTCGAGAACATGCTACTAACTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005252.2-684s1c1
Sequence:CCGGTCTGCTTTGCAGACCGAGATTCTCGAGAATCTCGGTCTGCAAAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005252.2-654s21c1
Sequence:CCGGGCGGAGACAGACCAACTAGAACTCGAGTTCTAGTTGGTCTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005252.2-319s21c1
Sequence:CCGGTCTCCAGTGCCAACTTCATTCCTCGAGGAATGAAGTTGGCACTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005252.2-1657s21c1
Sequence:CCGGTTAACCTGGTGCTGGATATTTCTCGAGAAATATCCAGCACCAGGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005252.2-596s21c1
Sequence:CCGGTAAGATGGCTGCAGCCAAATGCTCGAGCATTTGGCTGCAGCCATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005252.2-1033s21c1
Sequence:CCGGACCTATCTGGGTCCTTCTATGCTCGAGCATAGAAGGACCCAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005252
VALIDATED
FOS MISSION shRNA shRNA Plasmid DNA
FBJ murine osteosarcoma viral oncogene homolog
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005252.2-654s1c1
Sequence:CCGGGCGGAGACAGACCAACTAGAACTCGAGTTCTAGTTGGTCTGTCTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005252.2-540s1c1
Sequence:CCGGGTGGAACAGTTATCTCCAGAACTCGAGTTCTGGAGATAACTGTTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005252.2-1157s1c1
Sequence:CCGGCACTGCTTACACGTCTTCCTTCTCGAGAAGGAAGACGTGTAAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005252.2-1551s1c1
Sequence:CCGGGCTGGTAGTTAGTAGCATGTTCTCGAGAACATGCTACTAACTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005252.2-684s1c1
Sequence:CCGGTCTGCTTTGCAGACCGAGATTCTCGAGAATCTCGGTCTGCAAAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005252.2-654s21c1
Sequence:CCGGGCGGAGACAGACCAACTAGAACTCGAGTTCTAGTTGGTCTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005252.2-319s21c1
Sequence:CCGGTCTCCAGTGCCAACTTCATTCCTCGAGGAATGAAGTTGGCACTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005252.2-1657s21c1
Sequence:CCGGTTAACCTGGTGCTGGATATTTCTCGAGAAATATCCAGCACCAGGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005252.2-596s21c1
Sequence:CCGGTAAGATGGCTGCAGCCAAATGCTCGAGCATTTGGCTGCAGCCATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005252.2-1033s21c1
Sequence:CCGGACCTATCTGGGTCCTTCTATGCTCGAGCATAGAAGGACCCAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005252
VALIDATED
FOS MISSION shRNA Lentiviral Transduction Particles
FBJ murine osteosarcoma viral oncogene homolog
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005252.2-654s1c1
Sequence:CCGGGCGGAGACAGACCAACTAGAACTCGAGTTCTAGTTGGTCTGTCTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005252.2-540s1c1
Sequence:CCGGGTGGAACAGTTATCTCCAGAACTCGAGTTCTGGAGATAACTGTTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005252.2-1157s1c1
Sequence:CCGGCACTGCTTACACGTCTTCCTTCTCGAGAAGGAAGACGTGTAAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005252.2-1551s1c1
Sequence:CCGGGCTGGTAGTTAGTAGCATGTTCTCGAGAACATGCTACTAACTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005252.2-684s1c1
Sequence:CCGGTCTGCTTTGCAGACCGAGATTCTCGAGAATCTCGGTCTGCAAAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005252.2-654s21c1
Sequence:CCGGGCGGAGACAGACCAACTAGAACTCGAGTTCTAGTTGGTCTGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005252.2-319s21c1
Sequence:CCGGTCTCCAGTGCCAACTTCATTCCTCGAGGAATGAAGTTGGCACTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005252.2-1657s21c1
Sequence:CCGGTTAACCTGGTGCTGGATATTTCTCGAGAAATATCCAGCACCAGGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005252.2-596s21c1
Sequence:CCGGTAAGATGGCTGCAGCCAAATGCTCGAGCATTTGGCTGCAGCCATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005252.2-1033s21c1
Sequence:CCGGACCTATCTGGGTCCTTCTATGCTCGAGCATAGAAGGACCCAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks