EMAIL THIS PAGE TO A FRIEND

FOSB

FBJ murine osteosarcoma viral oncogene homolog B

190 Gene Product Result for
Synonyms: AP-1 G0S3 GOS3 GOSB
UniProtKB ID: P53539, A8K9K5, A8VJE1, E9PHJ3
Gene ID:
Human(2354) Summary: The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14282) FBJ osteosarcoma oncogene B
Rat(100360880) FBJ osteosarcoma oncogene B
Zebrafish(492346) FBJ murine osteosarcoma viral oncogene homolog B
cow(540819) FBJ murine osteosarcoma viral oncogene homolog B
domestic cat(101095060) FBJ murine osteosarcoma viral oncogene homolog B
dog(484445) FBJ murine osteosarcoma viral oncogene homolog B
domestic guinea pig(100734694) FBJ murine osteosarcoma viral oncogene homolog B
naked mole-rat(101701147) FBJ murine osteosarcoma viral oncogene homolog B
sheep(101117101) FBJ murine osteosarcoma viral oncogene homolog B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006732 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008036 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008036 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008036 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034891 MISSION® esiRNA esiRNA human FOSB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114171 Rosetta Predictions human pricing
NM_006732 Rosetta Predictions human pricing
NM_008036 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326404 predicted 1845
2 SASI_Hs02_00326405 predicted 742
3 SASI_Hs02_00326406 predicted 1104
4 SASI_Hs02_00326407 predicted 1209
5 SASI_Hs02_00326408 predicted 1449
6 SASI_Hs02_00326409 predicted 1767
7 SASI_Hs02_00326410 predicted 1621
8 SASI_Hs02_00326411 predicted 1075
9 SASI_Hs02_00326412 predicted 1078
10 SASI_Hs02_00326413 predicted 1366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342171 predicted 1953
2 SASI_Hs01_00168899 predicted 742
3 SASI_Hs01_00168890 predicted 1212
4 SASI_Hs02_00342172 predicted 1556
5 SASI_Hs02_00342173 predicted 1876
6 SASI_Hs02_00342174 predicted 1728
7 SASI_Hs01_00168893 predicted 1178
8 SASI_Hs01_00168896 predicted 1180
9 SASI_Hs02_00342175 predicted 1469
10 SASI_Hs02_00342176 predicted 1241
11 SASI_Hs01_00168891 predicted 1319
12 SASI_Hs01_00168892 predicted 1240
13 SASI_Hs01_00168894 predicted 955
14 SASI_Hs01_00168895 predicted 1149
15 SASI_Hs01_00168897 predicted 1946
16 SASI_Hs01_00168898 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008036 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145146 predicted 1167
2 SASI_Mm01_00145147 predicted 884
3 SASI_Mm01_00145148 predicted 653
4 SASI_Mm01_00145149 predicted 1149
5 SASI_Mm01_00145150 predicted 1967
6 SASI_Mm01_00145151 predicted 2050
7 SASI_Mm01_00145152 predicted 1232
8 SASI_Mm01_00145153 predicted 1327
9 SASI_Mm01_00145154 predicted 2042
10 SASI_Mm02_00312994 predicted 980
11 SASI_Mm01_00145155 predicted 2718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006732
FOSB MISSION shRNA Bacterial Glycerol Stock
FBJ murine osteosarcoma viral oncogene homolog B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006732.2-1767s21c1
Sequence:CCGGATCGGACAGGAGGATTCCTTGCTCGAGCAAGGAATCCTCCTGTCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006732.2-1597s21c1
Sequence:CCGGCCTCGCTCTGTGAACTCTTTACTCGAGTAAAGAGTTCACAGAGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006732.1-654s1c1
Sequence:CCGGGCCGAGTCTCAATATCTGTCTCTCGAGAGACAGATATTGAGACTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006732.1-3610s1c1
Sequence:CCGGGCCAACCACAATTCAATGAATCTCGAGATTCATTGAATTGTGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006732.1-1485s1c1
Sequence:CCGGCCTTCGTACACTTCTTCGTTTCTCGAGAAACGAAGAAGTGTACGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006732.1-1142s1c1
Sequence:CCGGCCAGGCGGAGACAGATCAGTTCTCGAGAACTGATCTGTCTCCGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006732.1-1077s1c1
Sequence:CCGGCGGGAACGAAATAAACTAGCACTCGAGTGCTAGTTTATTTCGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006732
FOSB MISSION shRNA shRNA Plasmid DNA
FBJ murine osteosarcoma viral oncogene homolog B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006732.2-1767s21c1
Sequence:CCGGATCGGACAGGAGGATTCCTTGCTCGAGCAAGGAATCCTCCTGTCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006732.2-1597s21c1
Sequence:CCGGCCTCGCTCTGTGAACTCTTTACTCGAGTAAAGAGTTCACAGAGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006732.1-654s1c1
Sequence:CCGGGCCGAGTCTCAATATCTGTCTCTCGAGAGACAGATATTGAGACTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006732.1-3610s1c1
Sequence:CCGGGCCAACCACAATTCAATGAATCTCGAGATTCATTGAATTGTGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006732.1-1485s1c1
Sequence:CCGGCCTTCGTACACTTCTTCGTTTCTCGAGAAACGAAGAAGTGTACGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006732.1-1142s1c1
Sequence:CCGGCCAGGCGGAGACAGATCAGTTCTCGAGAACTGATCTGTCTCCGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006732.1-1077s1c1
Sequence:CCGGCGGGAACGAAATAAACTAGCACTCGAGTGCTAGTTTATTTCGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006732
FOSB MISSION shRNA Lentiviral Transduction Particles
FBJ murine osteosarcoma viral oncogene homolog B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006732.2-1767s21c1
Sequence:CCGGATCGGACAGGAGGATTCCTTGCTCGAGCAAGGAATCCTCCTGTCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006732.2-1597s21c1
Sequence:CCGGCCTCGCTCTGTGAACTCTTTACTCGAGTAAAGAGTTCACAGAGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006732.1-654s1c1
Sequence:CCGGGCCGAGTCTCAATATCTGTCTCTCGAGAGACAGATATTGAGACTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006732.1-3610s1c1
Sequence:CCGGGCCAACCACAATTCAATGAATCTCGAGATTCATTGAATTGTGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006732.1-1485s1c1
Sequence:CCGGCCTTCGTACACTTCTTCGTTTCTCGAGAAACGAAGAAGTGTACGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006732.1-1142s1c1
Sequence:CCGGCCAGGCGGAGACAGATCAGTTCTCGAGAACTGATCTGTCTCCGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006732.1-1077s1c1
Sequence:CCGGCGGGAACGAAATAAACTAGCACTCGAGTGCTAGTTTATTTCGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008036
VALIDATED
FOSB MISSION shRNA Bacterial Glycerol Stock
FBJ murine osteosarcoma viral oncogene homolog B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008036.2-781s21c1
Sequence:CCGGCAACGGTCACCGCAATCACAACTCGAGTTGTGATTGCGGTGACCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008036.2-1153s21c1
Sequence:CCGGCAGATCGACTTCAGGCGGAAACTCGAGTTTCCGCCTGAAGTCGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008036.2-1775s21c1
Sequence:CCGGATGACGGAAGGACCTCCTTTGCTCGAGCAAAGGAGGTCCTTCCGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008036.2-2061s21c1
Sequence:CCGGAGAGAGACCCAACGAGGAAATCTCGAGATTTCCTCGTTGGGTCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008036.1-2477s1c1
Sequence:CCGGCCTGCATATCTTTGTCCTGTTCTCGAGAACAGGACAAAGATATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008036.1-2039s1c1
Sequence:CCGGCTCTTTACACACAGTGAAGTTCTCGAGAACTTCACTGTGTGTAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008036.1-1485s1c1
Sequence:CCGGACCCTTATGACATGCCAGGAACTCGAGTTCCTGGCATGTCATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008036.1-2093s1c1
Sequence:CCGGCCTTCGTACACTTCCTCGTTTCTCGAGAAACGAGGAAGTGTACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008036.1-1924s1c1
Sequence:CCGGGCCAGGGTCAACATCCGCTAACTCGAGTTAGCGGATGTTGACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008036
VALIDATED
FOSB MISSION shRNA shRNA Plasmid DNA
FBJ murine osteosarcoma viral oncogene homolog B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008036.2-781s21c1
Sequence:CCGGCAACGGTCACCGCAATCACAACTCGAGTTGTGATTGCGGTGACCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008036.2-1153s21c1
Sequence:CCGGCAGATCGACTTCAGGCGGAAACTCGAGTTTCCGCCTGAAGTCGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008036.2-1775s21c1
Sequence:CCGGATGACGGAAGGACCTCCTTTGCTCGAGCAAAGGAGGTCCTTCCGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008036.2-2061s21c1
Sequence:CCGGAGAGAGACCCAACGAGGAAATCTCGAGATTTCCTCGTTGGGTCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008036.1-2477s1c1
Sequence:CCGGCCTGCATATCTTTGTCCTGTTCTCGAGAACAGGACAAAGATATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008036.1-2039s1c1
Sequence:CCGGCTCTTTACACACAGTGAAGTTCTCGAGAACTTCACTGTGTGTAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008036.1-1485s1c1
Sequence:CCGGACCCTTATGACATGCCAGGAACTCGAGTTCCTGGCATGTCATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008036.1-2093s1c1
Sequence:CCGGCCTTCGTACACTTCCTCGTTTCTCGAGAAACGAGGAAGTGTACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008036.1-1924s1c1
Sequence:CCGGGCCAGGGTCAACATCCGCTAACTCGAGTTAGCGGATGTTGACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008036
VALIDATED
FOSB MISSION shRNA Lentiviral Transduction Particles
FBJ murine osteosarcoma viral oncogene homolog B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008036.2-781s21c1
Sequence:CCGGCAACGGTCACCGCAATCACAACTCGAGTTGTGATTGCGGTGACCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008036.2-1153s21c1
Sequence:CCGGCAGATCGACTTCAGGCGGAAACTCGAGTTTCCGCCTGAAGTCGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008036.2-1775s21c1
Sequence:CCGGATGACGGAAGGACCTCCTTTGCTCGAGCAAAGGAGGTCCTTCCGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008036.2-2061s21c1
Sequence:CCGGAGAGAGACCCAACGAGGAAATCTCGAGATTTCCTCGTTGGGTCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008036.1-2477s1c1
Sequence:CCGGCCTGCATATCTTTGTCCTGTTCTCGAGAACAGGACAAAGATATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008036.1-2039s1c1
Sequence:CCGGCTCTTTACACACAGTGAAGTTCTCGAGAACTTCACTGTGTGTAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008036.1-1485s1c1
Sequence:CCGGACCCTTATGACATGCCAGGAACTCGAGTTCCTGGCATGTCATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008036.1-2093s1c1
Sequence:CCGGCCTTCGTACACTTCCTCGTTTCTCGAGAAACGAGGAAGTGTACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008036.1-1924s1c1
Sequence:CCGGGCCAGGGTCAACATCCGCTAACTCGAGTTAGCGGATGTTGACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks