EMAIL THIS PAGE TO A FRIEND

FOSL1

FOS-like antigen 1

117 Gene Product Result for
Synonyms: FRA FRA1 fra-1
UniProtKB ID: P15407, Q6FG51
Gene ID:
Human(8061) Summary: The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. [provided by RefSeq, Jul 2008]
Mouse(14283) fos-like antigen 1
Rat(25445) fos-like antigen 1
sheep(101111137) FOS-like antigen 1
naked mole-rat(101707849) FOS-like antigen 1
domestic guinea pig(100734428) FOS-like antigen 1
cow(531389) FOS-like antigen 1
domestic cat(101101337) FOS-like antigen 1
dog(483724) FOS-like antigen 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108461 Anti-FOSL1 affinity isolated antibody guinea pig, mouse, rabbit, rat, human, canine, horse, bovine, zebrafish, sheep
immunohistochemistry, western blot pricing
SAB1406640 Anti-FOSL1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108319 Anti-FOSL1 antibody produced in rabbit affinity isolated antibody canine, zebrafish, human, mouse, bovine, horse, rabbit, rat, guinea pig
immunohistochemistry, western blot pricing
AV31377 Anti-FOSL1 antibody produced in rabbit affinity isolated antibody bovine, horse, human, rat, zebrafish, canine, mouse, rabbit, guinea pig, sheep
immunohistochemistry, western blot pricing
SAB2104464 Anti-FOSL1 antibody produced in rabbit affinity isolated antibody, lyophilized powder human, mouse, rat, bovine, chicken, rabbit, canine, zebrafish, horse
western blot pricing
SAB1411459 Anti-FOSL1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA066901 Anti-FOSL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4503209 Anti-FRA-1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB2500425 Anti-FRA1/FOSL1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005438 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010235 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010235 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010235 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005438 Rosetta Predictions human pricing
NM_012953 Rosetta Predictions rat pricing
NM_010235 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191186 predicted 1078
2 SASI_Hs02_00339593 predicted 1200
3 SASI_Hs01_00191187 predicted 1172
4 SASI_Hs01_00191189 predicted 1019
5 SASI_Hs01_00191190 predicted 1394
6 SASI_Hs01_00191191 predicted 971
7 SASI_Hs02_00339594 predicted 1358
8 SASI_Hs01_00191192 predicted 1209
9 SASI_Hs01_00191193 predicted 1122
10 SASI_Hs01_00191194 predicted 1401
11 SASI_Hs01_00191188 predicted 507
12 SASI_Hs01_00191195 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037358 predicted 1408
2 SASI_Rn01_00037359 predicted 1398
3 SASI_Rn01_00037362 predicted 776
4 SASI_Rn01_00037363 predicted 1285
5 SASI_Rn01_00037364 predicted 593
6 SASI_Rn01_00037365 predicted 1239
7 SASI_Rn02_00260538 predicted 1241
8 SASI_Rn01_00037367 predicted 1225
9 SASI_Rn02_00260539 predicted 1240
10 SASI_Rn02_00260540 predicted 1421
11 SASI_Rn01_00037360 predicted 1359
12 SASI_Rn01_00037361 predicted 973
13 SASI_Rn01_00037366 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062525 predicted 1183
2 SASI_Mm01_00062526 predicted 658
3 SASI_Mm02_00318095 predicted 661
4 SASI_Mm01_00062527 predicted 1080
5 SASI_Mm01_00062529 predicted 1453
6 SASI_Mm01_00062530 predicted 847
7 SASI_Mm01_00062531 predicted 1257
8 SASI_Mm01_00062532 predicted 961
9 SASI_Mm01_00062533 predicted 1271
10 SASI_Mm01_00062534 predicted 1444
11 SASI_Mm01_00062528 predicted 1440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005438
FOSL1 MISSION shRNA Bacterial Glycerol Stock
FOS-like antigen 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-780s1c1
Sequence:CCGGCTGTACCTTGTATCTCCCTTTCTCGAGAAAGGGAGATACAAGGTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-302s1c1
Sequence:CCGGCCAAGCATCAACACCATGAGTCTCGAGACTCATGGTGTTGATGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-339s1c1
Sequence:CCGGAGTGGATGGTACAGCCTCATTCTCGAGAATGAGGCTGTACCATCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-385s1c1
Sequence:CCGGGCCTCTGACCTACCCTCAGTACTCGAGTACTGAGGGTAGGTCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-921s1c1
Sequence:CCGGCCTCAGCTCATCGCAAGAGTACTCGAGTACTCTTGCGATGAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005438.3-461s21c1
Sequence:CCGGGTACGTCGAAGGCCTTGTGAACTCGAGTTCACAAGGCCTTCGACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005438
FOSL1 MISSION shRNA shRNA Plasmid DNA
FOS-like antigen 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-780s1c1
Sequence:CCGGCTGTACCTTGTATCTCCCTTTCTCGAGAAAGGGAGATACAAGGTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-302s1c1
Sequence:CCGGCCAAGCATCAACACCATGAGTCTCGAGACTCATGGTGTTGATGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-339s1c1
Sequence:CCGGAGTGGATGGTACAGCCTCATTCTCGAGAATGAGGCTGTACCATCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-385s1c1
Sequence:CCGGGCCTCTGACCTACCCTCAGTACTCGAGTACTGAGGGTAGGTCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-921s1c1
Sequence:CCGGCCTCAGCTCATCGCAAGAGTACTCGAGTACTCTTGCGATGAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005438.3-461s21c1
Sequence:CCGGGTACGTCGAAGGCCTTGTGAACTCGAGTTCACAAGGCCTTCGACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005438
FOSL1 MISSION shRNA Lentiviral Transduction Particles
FOS-like antigen 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-780s1c1
Sequence:CCGGCTGTACCTTGTATCTCCCTTTCTCGAGAAAGGGAGATACAAGGTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-302s1c1
Sequence:CCGGCCAAGCATCAACACCATGAGTCTCGAGACTCATGGTGTTGATGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-339s1c1
Sequence:CCGGAGTGGATGGTACAGCCTCATTCTCGAGAATGAGGCTGTACCATCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-385s1c1
Sequence:CCGGGCCTCTGACCTACCCTCAGTACTCGAGTACTGAGGGTAGGTCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005438.2-921s1c1
Sequence:CCGGCCTCAGCTCATCGCAAGAGTACTCGAGTACTCTTGCGATGAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005438.3-461s21c1
Sequence:CCGGGTACGTCGAAGGCCTTGTGAACTCGAGTTCACAAGGCCTTCGACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010235
VALIDATED
FOSL1 MISSION shRNA Bacterial Glycerol Stock
FOS-like antigen 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010235.1-664s1c1
Sequence:CCGGCGACAAATTGGAGGATGAGAACTCGAGTTCTCATCCTCCAATTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010235.1-1050s1c1
Sequence:CCGGGCTCTCCTACACTCCTGGCTTCTCGAGAAGCCAGGAGTGTAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010235.1-491s1c1
Sequence:CCGGCCAGGAGTCATACGAGCCCTACTCGAGTAGGGCTCGTATGACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010235.1-993s1c1
Sequence:CCGGCCTCCGCTCACCGAAAGAGTACTCGAGTACTCTTTCGGTGAGCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010235.1-851s1c1
Sequence:CCGGCCAGTGCCTTGCATCTCCCTTCTCGAGAAGGGAGATGCAAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-664s21c1
Sequence:CCGGCGACAAATTGGAGGATGAGAACTCGAGTTCTCATCCTCCAATTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-407s21c1
Sequence:CCGGTGGATGGTGCAGCCTCATTTCCTCGAGGAAATGAGGCTGCACCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-351s21c1
Sequence:CCGGAGCAGCAGAAGTTCCACCTTGCTCGAGCAAGGTGGAACTTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-369s21c1
Sequence:CCGGTTGTGCCAAGCATCGACAGCACTCGAGTGCTGTCGATGCTTGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-651s21c1
Sequence:CCGGTGCAGGCGGAGACCGACAAATCTCGAGATTTGTCGGTCTCCGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010235
VALIDATED
FOSL1 MISSION shRNA shRNA Plasmid DNA
FOS-like antigen 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010235.1-664s1c1
Sequence:CCGGCGACAAATTGGAGGATGAGAACTCGAGTTCTCATCCTCCAATTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010235.1-1050s1c1
Sequence:CCGGGCTCTCCTACACTCCTGGCTTCTCGAGAAGCCAGGAGTGTAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010235.1-491s1c1
Sequence:CCGGCCAGGAGTCATACGAGCCCTACTCGAGTAGGGCTCGTATGACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010235.1-993s1c1
Sequence:CCGGCCTCCGCTCACCGAAAGAGTACTCGAGTACTCTTTCGGTGAGCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010235.1-851s1c1
Sequence:CCGGCCAGTGCCTTGCATCTCCCTTCTCGAGAAGGGAGATGCAAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-664s21c1
Sequence:CCGGCGACAAATTGGAGGATGAGAACTCGAGTTCTCATCCTCCAATTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-407s21c1
Sequence:CCGGTGGATGGTGCAGCCTCATTTCCTCGAGGAAATGAGGCTGCACCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-351s21c1
Sequence:CCGGAGCAGCAGAAGTTCCACCTTGCTCGAGCAAGGTGGAACTTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-369s21c1
Sequence:CCGGTTGTGCCAAGCATCGACAGCACTCGAGTGCTGTCGATGCTTGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-651s21c1
Sequence:CCGGTGCAGGCGGAGACCGACAAATCTCGAGATTTGTCGGTCTCCGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010235
VALIDATED
FOSL1 MISSION shRNA Lentiviral Transduction Particles
FOS-like antigen 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010235.1-664s1c1
Sequence:CCGGCGACAAATTGGAGGATGAGAACTCGAGTTCTCATCCTCCAATTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010235.1-1050s1c1
Sequence:CCGGGCTCTCCTACACTCCTGGCTTCTCGAGAAGCCAGGAGTGTAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010235.1-491s1c1
Sequence:CCGGCCAGGAGTCATACGAGCCCTACTCGAGTAGGGCTCGTATGACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010235.1-993s1c1
Sequence:CCGGCCTCCGCTCACCGAAAGAGTACTCGAGTACTCTTTCGGTGAGCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010235.1-851s1c1
Sequence:CCGGCCAGTGCCTTGCATCTCCCTTCTCGAGAAGGGAGATGCAAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-664s21c1
Sequence:CCGGCGACAAATTGGAGGATGAGAACTCGAGTTCTCATCCTCCAATTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-407s21c1
Sequence:CCGGTGGATGGTGCAGCCTCATTTCCTCGAGGAAATGAGGCTGCACCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-351s21c1
Sequence:CCGGAGCAGCAGAAGTTCCACCTTGCTCGAGCAAGGTGGAACTTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-369s21c1
Sequence:CCGGTTGTGCCAAGCATCGACAGCACTCGAGTGCTGTCGATGCTTGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010235.2-651s21c1
Sequence:CCGGTGCAGGCGGAGACCGACAAATCTCGAGATTTGTCGGTCTCCGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks