EMAIL THIS PAGE TO A FRIEND

FOSL2

FOS-like antigen 2

158 Gene Product Result for
Synonyms: FRA2
UniProtKB ID: P15408, B2RD58, B3KP27, B4DYV4, Q6FG46
Gene ID:
Human(2355) Summary: The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. [provided by RefSeq, Jul 2008]
Mouse(14284) fos-like antigen 2
Rat(25446) fos-like antigen 2
Zebrafish(558921) fos-like antigen 2
cow(509889) FOS-like antigen 2
Horse(100071081) FOS-like antigen 2
domestic cat(101093515) FOS-like antigen 2
dog(608412) FOS-like antigen 2
chicken(421416) FOS-like antigen 2
domestic guinea pig(100727322) FOS-like antigen 2
naked mole-rat(101696928) FOS-like antigen 2
sheep(101122588) FOS-like antigen 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411950 ANTI-FOSL2 antibody produced in mouse clone 4F5-1B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA004817 Anti-FOSL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AV31277 Anti-FOSL2 antibody produced in rabbit affinity isolated antibody guinea pig, zebrafish, rabbit, human, mouse, rat, canine, horse, bovine
immunohistochemistry, western blot pricing
HPA061417 Anti-FOSL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501002 Anti-FRA-2, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
F139 Anti-Fra2 antibody produced in rabbit affinity isolated antibody, lyophilized powder human
western blot pricing
WH0002355M1 Monoclonal Anti-FOSL2 antibody produced in mouse clone 2B4-1C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403836 Monoclonal Anti-FOSL2 antibody produced in mouse clone 2B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005253 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008037 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008037 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008037 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072911 MISSION® esiRNA esiRNA human FOSL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005253 Rosetta Predictions human pricing
NM_012954 Rosetta Predictions rat pricing
NM_008037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057657 predicted 2160
2 SASI_Hs01_00057658 predicted 1767
3 SASI_Hs02_00339278 predicted 1535
4 SASI_Hs01_00057659 predicted 2109
5 SASI_Hs01_00057660 predicted 1688
6 SASI_Hs01_00057661 predicted 2280
7 SASI_Hs01_00057662 predicted 1949
8 SASI_Hs01_00057663 predicted 902
9 SASI_Hs01_00057664 predicted 1934
10 SASI_Hs01_00057665 predicted 1096
11 SASI_Hs01_00057666 predicted 1649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096262 predicted 731
2 SASI_Rn01_00096263 predicted 379
3 SASI_Rn01_00096264 predicted 444
4 SASI_Rn01_00096265 predicted 480
5 SASI_Rn01_00096266 predicted 436
6 SASI_Rn01_00096267 predicted 305
7 SASI_Rn01_00096268 predicted 686
8 SASI_Rn02_00260541 predicted 201
9 SASI_Rn02_00260542 predicted 202
10 SASI_Rn01_00096270 predicted 486
11 SASI_Rn01_00096269 predicted 518
12 SASI_Rn01_00096271 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201000 predicted 545
2 SASI_Mm01_00201001 predicted 549
3 SASI_Mm01_00201002 predicted 991
4 SASI_Mm01_00201003 predicted 346
5 SASI_Mm01_00201004 predicted 1174
6 SASI_Mm01_00201005 predicted 982
7 SASI_Mm01_00201006 predicted 1178
8 SASI_Mm01_00201007 predicted 979
9 SASI_Mm01_00201008 predicted 1133
10 SASI_Mm01_00201009 predicted 1188
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005253
VALIDATED
FOSL2 MISSION shRNA Bacterial Glycerol Stock
FOS-like antigen 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005253.3-1535s21c1
Sequence:CCGGGCGCTCTGTCATCAAGCCCATCTCGAGATGGGCTTGATGACAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005253.3-908s21c1
Sequence:CCGGGCAGAAATTCCGGGTAGATATCTCGAGATATCTACCCGGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005253.3-1368s21c1
Sequence:CCGGCACGGCCCAGTGTGCAAGATTCTCGAGAATCTTGCACACTGGGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005253.3-1943s21c1
Sequence:CCGGGCAGTGAGTATTGGAAGACTTCTCGAGAAGTCTTCCAATACTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005253.3-906s1c1
Sequence:CCGGCAGCAGAAATTCCGGGTAGATCTCGAGATCTACCCGGAATTTCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005253.3-1943s1c1
Sequence:CCGGGCAGTGAGTATTGGAAGACTTCTCGAGAAGTCTTCCAATACTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005253.3-1535s1c1
Sequence:CCGGGCGCTCTGTCATCAAGCCCATCTCGAGATGGGCTTGATGACAGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005253.3-1016s1c1
Sequence:CCGGCACCTCCATGTCCAACCCATACTCGAGTATGGGTTGGACATGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005253.3-1368s1c1
Sequence:CCGGCACGGCCCAGTGTGCAAGATTCTCGAGAATCTTGCACACTGGGCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005253
VALIDATED
FOSL2 MISSION shRNA shRNA Plasmid DNA
FOS-like antigen 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005253.3-1535s21c1
Sequence:CCGGGCGCTCTGTCATCAAGCCCATCTCGAGATGGGCTTGATGACAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005253.3-908s21c1
Sequence:CCGGGCAGAAATTCCGGGTAGATATCTCGAGATATCTACCCGGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005253.3-1368s21c1
Sequence:CCGGCACGGCCCAGTGTGCAAGATTCTCGAGAATCTTGCACACTGGGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005253.3-1943s21c1
Sequence:CCGGGCAGTGAGTATTGGAAGACTTCTCGAGAAGTCTTCCAATACTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005253.3-906s1c1
Sequence:CCGGCAGCAGAAATTCCGGGTAGATCTCGAGATCTACCCGGAATTTCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005253.3-1943s1c1
Sequence:CCGGGCAGTGAGTATTGGAAGACTTCTCGAGAAGTCTTCCAATACTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005253.3-1535s1c1
Sequence:CCGGGCGCTCTGTCATCAAGCCCATCTCGAGATGGGCTTGATGACAGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005253.3-1016s1c1
Sequence:CCGGCACCTCCATGTCCAACCCATACTCGAGTATGGGTTGGACATGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005253.3-1368s1c1
Sequence:CCGGCACGGCCCAGTGTGCAAGATTCTCGAGAATCTTGCACACTGGGCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005253
VALIDATED
FOSL2 MISSION shRNA Lentiviral Transduction Particles
FOS-like antigen 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005253.3-1535s21c1
Sequence:CCGGGCGCTCTGTCATCAAGCCCATCTCGAGATGGGCTTGATGACAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005253.3-908s21c1
Sequence:CCGGGCAGAAATTCCGGGTAGATATCTCGAGATATCTACCCGGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005253.3-1368s21c1
Sequence:CCGGCACGGCCCAGTGTGCAAGATTCTCGAGAATCTTGCACACTGGGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005253.3-1943s21c1
Sequence:CCGGGCAGTGAGTATTGGAAGACTTCTCGAGAAGTCTTCCAATACTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005253.3-906s1c1
Sequence:CCGGCAGCAGAAATTCCGGGTAGATCTCGAGATCTACCCGGAATTTCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005253.3-1943s1c1
Sequence:CCGGGCAGTGAGTATTGGAAGACTTCTCGAGAAGTCTTCCAATACTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005253.3-1535s1c1
Sequence:CCGGGCGCTCTGTCATCAAGCCCATCTCGAGATGGGCTTGATGACAGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005253.3-1016s1c1
Sequence:CCGGCACCTCCATGTCCAACCCATACTCGAGTATGGGTTGGACATGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005253.3-1368s1c1
Sequence:CCGGCACGGCCCAGTGTGCAAGATTCTCGAGAATCTTGCACACTGGGCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008037
VALIDATED
FOSL2 MISSION shRNA Bacterial Glycerol Stock
FOS-like antigen 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008037.3-397s21c1
Sequence:CCGGATCCACGCTCACATCCCTACACTCGAGTGTAGGGATGTGAGCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008037.3-372s21c1
Sequence:CCGGGTGATCACCTCCATGTCCAATCTCGAGATTGGACATGGAGGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008037.3-1950s21c1
Sequence:CCGGGGTTTGCCAAACGTCTAATTACTCGAGTAATTAGACGTTTGGCAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008037.3-1133s21c1
Sequence:CCGGCACACTTCTAGCCCTGTAACCCTCGAGGGTTACAGGGCTAGAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008037.3-900s21c1
Sequence:CCGGGTCATCAAGCCCATCAGCATCCTCGAGGATGCTGATGGGCTTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008037.3-995s1c1
Sequence:CCGGCGGCACTTCAAACCTTGTCTTCTCGAGAAGACAAGGTTTGAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008037.3-472s1c1
Sequence:CCGGGAGTGATCAAGACCATCGGTACTCGAGTACCGATGGTCTTGATCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008037.3-267s1c1
Sequence:CCGGCAGCAGAAGTTCCGGGTAGATCTCGAGATCTACCCGGAACTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008037.3-668s1c1
Sequence:CCGGGCAGAAAGAGATTGCTGAGCTCTCGAGAGCTCAGCAATCTCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008037.3-1106s1c1
Sequence:CCGGCCAGTCATCAGACTCCTTGAACTCGAGTTCAAGGAGTCTGATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008037.3-267s1c2
Sequence:CCGGCAGCAGAAGTTCCGGGTAGATCTCGAGATCTACCCGGAACTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008037
VALIDATED
FOSL2 MISSION shRNA shRNA Plasmid DNA
FOS-like antigen 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008037.3-397s21c1
Sequence:CCGGATCCACGCTCACATCCCTACACTCGAGTGTAGGGATGTGAGCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008037.3-372s21c1
Sequence:CCGGGTGATCACCTCCATGTCCAATCTCGAGATTGGACATGGAGGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008037.3-1950s21c1
Sequence:CCGGGGTTTGCCAAACGTCTAATTACTCGAGTAATTAGACGTTTGGCAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008037.3-1133s21c1
Sequence:CCGGCACACTTCTAGCCCTGTAACCCTCGAGGGTTACAGGGCTAGAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008037.3-900s21c1
Sequence:CCGGGTCATCAAGCCCATCAGCATCCTCGAGGATGCTGATGGGCTTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008037.3-995s1c1
Sequence:CCGGCGGCACTTCAAACCTTGTCTTCTCGAGAAGACAAGGTTTGAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008037.3-472s1c1
Sequence:CCGGGAGTGATCAAGACCATCGGTACTCGAGTACCGATGGTCTTGATCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008037.3-267s1c1
Sequence:CCGGCAGCAGAAGTTCCGGGTAGATCTCGAGATCTACCCGGAACTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008037.3-668s1c1
Sequence:CCGGGCAGAAAGAGATTGCTGAGCTCTCGAGAGCTCAGCAATCTCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008037.3-1106s1c1
Sequence:CCGGCCAGTCATCAGACTCCTTGAACTCGAGTTCAAGGAGTCTGATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008037.3-267s1c2
Sequence:CCGGCAGCAGAAGTTCCGGGTAGATCTCGAGATCTACCCGGAACTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008037
VALIDATED
FOSL2 MISSION shRNA Lentiviral Transduction Particles
FOS-like antigen 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008037.3-397s21c1
Sequence:CCGGATCCACGCTCACATCCCTACACTCGAGTGTAGGGATGTGAGCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008037.3-372s21c1
Sequence:CCGGGTGATCACCTCCATGTCCAATCTCGAGATTGGACATGGAGGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008037.3-1950s21c1
Sequence:CCGGGGTTTGCCAAACGTCTAATTACTCGAGTAATTAGACGTTTGGCAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008037.3-1133s21c1
Sequence:CCGGCACACTTCTAGCCCTGTAACCCTCGAGGGTTACAGGGCTAGAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008037.3-900s21c1
Sequence:CCGGGTCATCAAGCCCATCAGCATCCTCGAGGATGCTGATGGGCTTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008037.3-995s1c1
Sequence:CCGGCGGCACTTCAAACCTTGTCTTCTCGAGAAGACAAGGTTTGAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008037.3-472s1c1
Sequence:CCGGGAGTGATCAAGACCATCGGTACTCGAGTACCGATGGTCTTGATCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008037.3-267s1c1
Sequence:CCGGCAGCAGAAGTTCCGGGTAGATCTCGAGATCTACCCGGAACTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008037.3-668s1c1
Sequence:CCGGGCAGAAAGAGATTGCTGAGCTCTCGAGAGCTCAGCAATCTCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008037.3-1106s1c1
Sequence:CCGGCCAGTCATCAGACTCCTTGAACTCGAGTTCAAGGAGTCTGATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008037.3-267s1c2
Sequence:CCGGCAGCAGAAGTTCCGGGTAGATCTCGAGATCTACCCGGAACTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks