EMAIL THIS PAGE TO A FRIEND

FOXA1

forkhead box A1

144 Gene Product Result for
Synonyms: HNF3A TCF3A
UniProtKB ID: P55317, B2R9H6, Q9H2A0
Gene ID:
Human(3169) Summary: This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific transcripts such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. [provided by RefSeq, Jul 2008]
Mouse(15375) forkhead box A1
Rat(25098) forkhead box A1
Zebrafish(30541) forkhead box A1
cow(503579) forkhead box A1
domestic cat(101085896) forkhead box A1
dog(490657) forkhead box A1
chicken(101752179) forkhead box A1
chicken(101664992) forkhead box A1
sheep(101106037) forkhead box A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100834 Anti-FOXA1 (ab1) antibody produced in rabbit affinity isolated antibody zebrafish, human, canine, guinea pig, rabbit, bovine, mouse, rat
western blot pricing
SAB2100835 Anti-FOXA1 (ab2) antibody produced in rabbit affinity isolated antibody human, rat, mouse, canine
western blot pricing
F1555 Anti-FOXA1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
AV32630 Anti-FOXA1 antibody produced in rabbit affinity isolated antibody bovine, canine, mouse, guinea pig, zebrafish, rat, human
western blot pricing
HPA050505 Anti-FOXA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB5500107 Anti-FOXA1 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP88, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB2500408 Anti-FOXA1/HNF3A antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
WH0003169M1 Monoclonal Anti-FOXA1 antibody produced in mouse clone 2D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB3300052 Monoclonal Anti-FOXA1 antibody produced in mouse clone 3C1, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing
SAB1403928 Monoclonal Anti-FOXA1, (C-terminal) antibody produced in mouse clone 1B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008259 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008259 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008259 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004496 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004496 Rosetta Predictions human pricing
NM_012742 Rosetta Predictions rat pricing
NM_008259 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168403 predicted 1802
2 SASI_Hs01_00168404 predicted 1678
3 SASI_Hs01_00168405 predicted 1589
4 SASI_Hs01_00168407 predicted 1560
5 SASI_Hs01_00168406 predicted 463
6 SASI_Hs02_00337745 predicted 2173
7 SASI_Hs02_00337746 predicted 2171
8 SASI_Hs02_00337747 predicted 1979
9 SASI_Hs02_00337748 predicted 1812
10 SASI_Hs02_00337749 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041537 predicted 1855
2 SASI_Rn01_00041538 predicted 1901
3 SASI_Rn01_00041539 predicted 822
4 SASI_Rn01_00041540 predicted 1941
5 SASI_Rn01_00041541 predicted 607
6 SASI_Rn01_00041542 predicted 818
7 SASI_Rn01_00041543 predicted 1901
8 SASI_Rn01_00041544 predicted 1852
9 SASI_Rn01_00041545 predicted 465
10 SASI_Rn01_00041546 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061098 predicted 1408
2 SASI_Mm01_00061099 predicted 1513
3 SASI_Mm02_00313473 predicted 411
4 SASI_Mm01_00061101 predicted 2135
5 SASI_Mm01_00061102 predicted 2252
6 SASI_Mm01_00061104 predicted 496
7 SASI_Mm01_00061106 predicted 1582
8 SASI_Mm02_00313474 predicted 2241
9 SASI_Mm01_00061107 predicted 789
10 SASI_Mm02_00313475 predicted 1308
11 SASI_Mm01_00061100 predicted 2284
12 SASI_Mm01_00061103 predicted 1651
13 SASI_Mm01_00061105 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008259
VALIDATED
FOXA1 MISSION shRNA Bacterial Glycerol Stock
forkhead box A1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008259.2-2022s1c1
Sequence:CCGGCCGACTCCATACCAACACTTTCTCGAGAAAGTGTTGGTATGGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008259.2-422s1c1
Sequence:CCGGCAACGACTGGAACAGCTACTACTCGAGTAGTAGCTGTTCCAGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008259.2-1763s1c1
Sequence:CCGGGTATTCCAGACCCGTGCTAAACTCGAGTTTAGCACGGGTCTGGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008259.2-863s1c1
Sequence:CCGGCAAGACATTCAAGCGCAGCTACTCGAGTAGCTGCGCTTGAATGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008259.2-1049s1c1
Sequence:CCGGGCTGTCCTTCAACGATTGTTTCTCGAGAAACAATCGTTGAAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008259.3-1641s21c1
Sequence:CCGGGCGCTGCAGTACTCTCCTTATCTCGAGATAAGGAGAGTACTGCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008259.3-2137s21c1
Sequence:CCGGTAGTTCCTGCAGGGCTTATTTCTCGAGAAATAAGCCCTGCAGGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008259
VALIDATED
FOXA1 MISSION shRNA shRNA Plasmid DNA
forkhead box A1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008259.2-2022s1c1
Sequence:CCGGCCGACTCCATACCAACACTTTCTCGAGAAAGTGTTGGTATGGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008259.2-422s1c1
Sequence:CCGGCAACGACTGGAACAGCTACTACTCGAGTAGTAGCTGTTCCAGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008259.2-1763s1c1
Sequence:CCGGGTATTCCAGACCCGTGCTAAACTCGAGTTTAGCACGGGTCTGGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008259.2-863s1c1
Sequence:CCGGCAAGACATTCAAGCGCAGCTACTCGAGTAGCTGCGCTTGAATGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008259.2-1049s1c1
Sequence:CCGGGCTGTCCTTCAACGATTGTTTCTCGAGAAACAATCGTTGAAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008259.3-1641s21c1
Sequence:CCGGGCGCTGCAGTACTCTCCTTATCTCGAGATAAGGAGAGTACTGCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008259.3-2137s21c1
Sequence:CCGGTAGTTCCTGCAGGGCTTATTTCTCGAGAAATAAGCCCTGCAGGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008259
VALIDATED
FOXA1 MISSION shRNA Lentiviral Transduction Particles
forkhead box A1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008259.2-2022s1c1
Sequence:CCGGCCGACTCCATACCAACACTTTCTCGAGAAAGTGTTGGTATGGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008259.2-422s1c1
Sequence:CCGGCAACGACTGGAACAGCTACTACTCGAGTAGTAGCTGTTCCAGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008259.2-1763s1c1
Sequence:CCGGGTATTCCAGACCCGTGCTAAACTCGAGTTTAGCACGGGTCTGGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008259.2-863s1c1
Sequence:CCGGCAAGACATTCAAGCGCAGCTACTCGAGTAGCTGCGCTTGAATGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008259.2-1049s1c1
Sequence:CCGGGCTGTCCTTCAACGATTGTTTCTCGAGAAACAATCGTTGAAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008259.3-1641s21c1
Sequence:CCGGGCGCTGCAGTACTCTCCTTATCTCGAGATAAGGAGAGTACTGCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008259.3-2137s21c1
Sequence:CCGGTAGTTCCTGCAGGGCTTATTTCTCGAGAAATAAGCCCTGCAGGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004496
FOXA1 MISSION shRNA Bacterial Glycerol Stock
forkhead box A1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004496.2-1972s1c1
Sequence:CCGGGCGAAGTTTAATGATCCACAACTCGAGTTGTGGATCATTAAACTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004496.2-435s1c1
Sequence:CCGGGAACTCCATGAACACCTACATCTCGAGATGTAGGTGTTCATGGAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004496.2-1684s1c1
Sequence:CCGGGCGTACTACCAAGGTGTGTATCTCGAGATACACACCTTGGTAGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004496.2-1545s1c1
Sequence:CCGGGCAGCATAAGCTGGACTTCAACTCGAGTTGAAGTCCAGCTTATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004496.2-444s1c1
Sequence:CCGGGAACACCTACATGACCATGAACTCGAGTTCATGGTCATGTAGGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004496.2-1569s21c1
Sequence:CCGGATACGAACAGGCACTGCAATACTCGAGTATTGCAGTGCCTGTTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004496.2-1815s21c1
Sequence:CCGGCAAACCGTCAACAGCATAATACTCGAGTATTATGCTGTTGACGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004496.2-2060s21c1
Sequence:CCGGTCTAGTTTGTGGAGGGTTATTCTCGAGAATAACCCTCCACAAACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004496.2-1701s21c1
Sequence:CCGGGTATTCCAGACCCGTCCTAAACTCGAGTTTAGGACGGGTCTGGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004496
FOXA1 MISSION shRNA shRNA Plasmid DNA
forkhead box A1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004496.2-1972s1c1
Sequence:CCGGGCGAAGTTTAATGATCCACAACTCGAGTTGTGGATCATTAAACTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004496.2-435s1c1
Sequence:CCGGGAACTCCATGAACACCTACATCTCGAGATGTAGGTGTTCATGGAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004496.2-1684s1c1
Sequence:CCGGGCGTACTACCAAGGTGTGTATCTCGAGATACACACCTTGGTAGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004496.2-1545s1c1
Sequence:CCGGGCAGCATAAGCTGGACTTCAACTCGAGTTGAAGTCCAGCTTATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004496.2-444s1c1
Sequence:CCGGGAACACCTACATGACCATGAACTCGAGTTCATGGTCATGTAGGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004496.2-1569s21c1
Sequence:CCGGATACGAACAGGCACTGCAATACTCGAGTATTGCAGTGCCTGTTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004496.2-1815s21c1
Sequence:CCGGCAAACCGTCAACAGCATAATACTCGAGTATTATGCTGTTGACGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004496.2-2060s21c1
Sequence:CCGGTCTAGTTTGTGGAGGGTTATTCTCGAGAATAACCCTCCACAAACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004496.2-1701s21c1
Sequence:CCGGGTATTCCAGACCCGTCCTAAACTCGAGTTTAGGACGGGTCTGGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004496
FOXA1 MISSION shRNA Lentiviral Transduction Particles
forkhead box A1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004496.2-1972s1c1
Sequence:CCGGGCGAAGTTTAATGATCCACAACTCGAGTTGTGGATCATTAAACTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004496.2-435s1c1
Sequence:CCGGGAACTCCATGAACACCTACATCTCGAGATGTAGGTGTTCATGGAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004496.2-1684s1c1
Sequence:CCGGGCGTACTACCAAGGTGTGTATCTCGAGATACACACCTTGGTAGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004496.2-1545s1c1
Sequence:CCGGGCAGCATAAGCTGGACTTCAACTCGAGTTGAAGTCCAGCTTATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004496.2-444s1c1
Sequence:CCGGGAACACCTACATGACCATGAACTCGAGTTCATGGTCATGTAGGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004496.2-1569s21c1
Sequence:CCGGATACGAACAGGCACTGCAATACTCGAGTATTGCAGTGCCTGTTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004496.2-1815s21c1
Sequence:CCGGCAAACCGTCAACAGCATAATACTCGAGTATTATGCTGTTGACGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004496.2-2060s21c1
Sequence:CCGGTCTAGTTTGTGGAGGGTTATTCTCGAGAATAACCCTCCACAAACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004496.2-1701s21c1
Sequence:CCGGGTATTCCAGACCCGTCCTAAACTCGAGTTTAGGACGGGTCTGGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks