EMAIL THIS PAGE TO A FRIEND

FOXA2

forkhead box A2

90 Gene Product Result for
Synonyms: HNF3B TCF3B
UniProtKB ID: Q9Y261, Q8WUW4, Q96DF7
Gene ID:
Human(3170) Summary: This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific genes such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. This gene has been linked to sporadic cases of maturity-onset diabetes of the young. Transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
Mouse(15376) forkhead box A2
Rat(25099) forkhead box A2
naked mole-rat(101699767) forkhead box A2
sheep(101103003) forkhead box A2
Zebrafish(30126) forkhead box A2
dog(485742) forkhead box A2
chicken(395539) forkhead box A2
cow(503580) forkhead box A2
domestic cat(101085112) forkhead box A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108523 Anti-FOXA2 IgG fraction of antiserum human, rabbit, zebrafish, bovine, pig, horse, guinea pig, mouse, rat
western blot pricing
F5181 Anti-FOXA2 (361-375) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
F5306 Anti-FOXA2 (401-415) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV39508 Anti-FOXA2 (AB1) antibody produced in rabbit IgG fraction of antiserum bovine, zebrafish, rabbit, human, rat, canine, mouse, guinea pig
western blot pricing
AV39509 Anti-FOXA2 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, horse, rabbit, canine, guinea pig, rat, human
western blot pricing
SAB2702435 Anti-Foxa2 antibody produced in rabbit affinity isolated antibody zebrafish
western blot pricing
SAB2100836 Anti-FOXA2 antibody produced in rabbit affinity isolated antibody rat, mouse, horse, rabbit, canine, human
western blot pricing
SAB2105304 Anti-FOXA2 antibody produced in rabbit affinity isolated antibody horse, mouse, rabbit, guinea pig
western blot pricing
HPA066846 Anti-FOXA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2105303 Anti-FOXA2, (C-terminal) antibody produced in rabbit affinity isolated antibody mouse
western blot pricing
SAB2500409 Anti-FOXA2/HNF3B antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
WH0003170M1 Monoclonal Anti-FOXA2 antibody produced in mouse clone 7E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB3300073 Monoclonal Anti-FOXA2 antibody produced in mouse clone 3C10, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
SAB1403929 Monoclonal Anti-FOXA2 antibody produced in mouse clone 1C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021784 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021784 Rosetta Predictions human pricing
NM_153675 Rosetta Predictions human pricing
NM_012743 Rosetta Predictions rat pricing
XM_579347 Rosetta Predictions rat pricing
NM_010446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187845 predicted 1068
2 SASI_Hs01_00187846 predicted 907
3 SASI_Hs01_00187848 predicted 1093
4 SASI_Hs01_00187849 predicted 873
5 SASI_Hs01_00187850 predicted 1089
6 SASI_Hs01_00187851 predicted 1088
7 SASI_Hs01_00187852 predicted 1004
8 SASI_Hs01_00187853 predicted 878
9 SASI_Hs01_00187854 predicted 888
10 SASI_Hs02_00355093 predicted 1100
11 SASI_Hs01_00187847 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164644 predicted 1053
2 SASI_Hs01_00164645 predicted 892
3 SASI_Hs01_00164647 predicted 1081
4 SASI_Hs01_00164648 predicted 869
5 SASI_Hs01_00164649 predicted 1078
6 SASI_Hs01_00164650 predicted 1075
7 SASI_Hs01_00164651 predicted 991
8 SASI_Hs01_00164652 predicted 867
9 SASI_Hs01_00164653 predicted 872
10 SASI_Hs02_00367392 predicted 1082
11 SASI_Hs01_00164646 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064309 predicted 1542
2 SASI_Rn01_00064310 predicted 1526
3 SASI_Rn01_00064311 predicted 252
4 SASI_Rn01_00064312 predicted 294
5 SASI_Rn01_00064313 predicted 1517
6 SASI_Rn01_00064315 predicted 558
7 SASI_Rn01_00064316 predicted 1399
8 SASI_Rn01_00064317 predicted 231
9 SASI_Rn01_00064318 predicted 383
10 SASI_Rn02_00260096 predicted 917
11 SASI_Rn01_00064314 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168772 predicted 255
2 SASI_Rn01_00168773 predicted 301
3 SASI_Rn01_00168774 predicted 369
4 SASI_Rn01_00168775 predicted 245
5 SASI_Rn01_00168776 predicted 261
6 SASI_Rn01_00168777 predicted 330
7 SASI_Rn01_00168778 predicted 375
8 SASI_Rn01_00168779 predicted 228
9 SASI_Rn01_00168780 predicted 233
10 SASI_Rn01_00168781 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139457 predicted 915
2 SASI_Mm01_00139458 predicted 579
3 SASI_Mm01_00139459 predicted 1587
4 SASI_Mm01_00139460 predicted 1318
5 SASI_Mm01_00139461 predicted 577
6 SASI_Mm01_00139462 predicted 819
7 SASI_Mm01_00139463 predicted 567
8 SASI_Mm01_00139464 predicted 1449
9 SASI_Mm01_00139465 predicted 1591
10 SASI_Mm01_00139466 predicted 1548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010446
FOXA2 MISSION shRNA Bacterial Glycerol Stock
forkhead box A2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010446.2-1649s21c1
Sequence:CCGGACAGTGATCTGTCATTCTAAACTCGAGTTTAGAATGACAGATCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010446.2-1062s21c1
Sequence:CCGGAGGTGGCCTAAGCGAGCTAAACTCGAGTTTAGCTCGCTTAGGCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010446.2-585s21c1
Sequence:CCGGCAAACCTCCCTACTCGTACATCTCGAGATGTACGAGTAGGGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010446.1-1435s1c1
Sequence:CCGGGCAGACACTTCCTACTACCAACTCGAGTTGGTAGTAGGAAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010446.1-1212s1c1
Sequence:CCGGCGAGCACCATTACGCCTTCAACTCGAGTTGAAGGCGTAATGGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010446.1-1470s1c1
Sequence:CCGGGCCTATTATGAACTCATCCTACTCGAGTAGGATGAGTTCATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010446.1-1722s1c1
Sequence:CCGGGCCTTTGGTCTCCTCTATGTACTCGAGTACATAGAGGAGACCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010446.1-489s1c1
Sequence:CCGGCTACGCCAACATGAACTCGATCTCGAGATCGAGTTCATGTTGGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010446
FOXA2 MISSION shRNA shRNA Plasmid DNA
forkhead box A2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010446.2-1649s21c1
Sequence:CCGGACAGTGATCTGTCATTCTAAACTCGAGTTTAGAATGACAGATCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010446.2-1062s21c1
Sequence:CCGGAGGTGGCCTAAGCGAGCTAAACTCGAGTTTAGCTCGCTTAGGCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010446.2-585s21c1
Sequence:CCGGCAAACCTCCCTACTCGTACATCTCGAGATGTACGAGTAGGGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010446.1-1435s1c1
Sequence:CCGGGCAGACACTTCCTACTACCAACTCGAGTTGGTAGTAGGAAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010446.1-1212s1c1
Sequence:CCGGCGAGCACCATTACGCCTTCAACTCGAGTTGAAGGCGTAATGGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010446.1-1470s1c1
Sequence:CCGGGCCTATTATGAACTCATCCTACTCGAGTAGGATGAGTTCATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010446.1-1722s1c1
Sequence:CCGGGCCTTTGGTCTCCTCTATGTACTCGAGTACATAGAGGAGACCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010446.1-489s1c1
Sequence:CCGGCTACGCCAACATGAACTCGATCTCGAGATCGAGTTCATGTTGGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010446
FOXA2 MISSION shRNA Lentiviral Transduction Particles
forkhead box A2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010446.2-1649s21c1
Sequence:CCGGACAGTGATCTGTCATTCTAAACTCGAGTTTAGAATGACAGATCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010446.2-1062s21c1
Sequence:CCGGAGGTGGCCTAAGCGAGCTAAACTCGAGTTTAGCTCGCTTAGGCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010446.2-585s21c1
Sequence:CCGGCAAACCTCCCTACTCGTACATCTCGAGATGTACGAGTAGGGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010446.1-1435s1c1
Sequence:CCGGGCAGACACTTCCTACTACCAACTCGAGTTGGTAGTAGGAAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010446.1-1212s1c1
Sequence:CCGGCGAGCACCATTACGCCTTCAACTCGAGTTGAAGGCGTAATGGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010446.1-1470s1c1
Sequence:CCGGGCCTATTATGAACTCATCCTACTCGAGTAGGATGAGTTCATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010446.1-1722s1c1
Sequence:CCGGGCCTTTGGTCTCCTCTATGTACTCGAGTACATAGAGGAGACCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010446.1-489s1c1
Sequence:CCGGCTACGCCAACATGAACTCGATCTCGAGATCGAGTTCATGTTGGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021784
VALIDATED
FOXA2 MISSION shRNA Bacterial Glycerol Stock
forkhead box A2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021784.4-316s21c1
Sequence:CCGGACGGCATGAACACGTACATGACTCGAGTCATGTACGTGTTCATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021784.4-1301s21c1
Sequence:CCGGGGAACACCACTACGCCTTCAACTCGAGTTGAAGGCGTAGTGGTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021784.4-1557s21c1
Sequence:CCGGCCCATTATGAACTCCTCTTAACTCGAGTTAAGAGGAGTTCATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021784.4-387s21c1
Sequence:CCGGTCCATGAACATGTCGTCGTACCTCGAGGTACGACGACATGTTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021784.4-1681s21c1
Sequence:CCGGGCAAGGGAGAAGAAATCCATACTCGAGTATGGATTTCTTCTCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_021784.3-1681s1c1
Sequence:CCGGGCAAGGGAGAAGAAATCCATACTCGAGTATGGATTTCTTCTCCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021784.3-1556s1c1
Sequence:CCGGGCCCATTATGAACTCCTCTTACTCGAGTAAGAGGAGTTCATAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021784.3-314s1c1
Sequence:CCGGGAACGGCATGAACACGTACATCTCGAGATGTACGTGTTCATGCCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021784.3-686s1c1
Sequence:CCGGCTACTCGTACATCTCGCTCATCTCGAGATGAGCGAGATGTACGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021784.3-581s1c1
Sequence:CCGGCTACGCCAACATGAACTCCATCTCGAGATGGAGTTCATGTTGGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021784
VALIDATED
FOXA2 MISSION shRNA shRNA Plasmid DNA
forkhead box A2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021784.4-316s21c1
Sequence:CCGGACGGCATGAACACGTACATGACTCGAGTCATGTACGTGTTCATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021784.4-1301s21c1
Sequence:CCGGGGAACACCACTACGCCTTCAACTCGAGTTGAAGGCGTAGTGGTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021784.4-1557s21c1
Sequence:CCGGCCCATTATGAACTCCTCTTAACTCGAGTTAAGAGGAGTTCATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021784.4-387s21c1
Sequence:CCGGTCCATGAACATGTCGTCGTACCTCGAGGTACGACGACATGTTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021784.4-1681s21c1
Sequence:CCGGGCAAGGGAGAAGAAATCCATACTCGAGTATGGATTTCTTCTCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_021784.3-1681s1c1
Sequence:CCGGGCAAGGGAGAAGAAATCCATACTCGAGTATGGATTTCTTCTCCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021784.3-1556s1c1
Sequence:CCGGGCCCATTATGAACTCCTCTTACTCGAGTAAGAGGAGTTCATAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021784.3-314s1c1
Sequence:CCGGGAACGGCATGAACACGTACATCTCGAGATGTACGTGTTCATGCCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021784.3-686s1c1
Sequence:CCGGCTACTCGTACATCTCGCTCATCTCGAGATGAGCGAGATGTACGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021784.3-581s1c1
Sequence:CCGGCTACGCCAACATGAACTCCATCTCGAGATGGAGTTCATGTTGGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021784
VALIDATED
FOXA2 MISSION shRNA Lentiviral Transduction Particles
forkhead box A2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021784.4-316s21c1
Sequence:CCGGACGGCATGAACACGTACATGACTCGAGTCATGTACGTGTTCATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021784.4-1301s21c1
Sequence:CCGGGGAACACCACTACGCCTTCAACTCGAGTTGAAGGCGTAGTGGTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021784.4-1557s21c1
Sequence:CCGGCCCATTATGAACTCCTCTTAACTCGAGTTAAGAGGAGTTCATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021784.4-387s21c1
Sequence:CCGGTCCATGAACATGTCGTCGTACCTCGAGGTACGACGACATGTTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021784.4-1681s21c1
Sequence:CCGGGCAAGGGAGAAGAAATCCATACTCGAGTATGGATTTCTTCTCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_021784.3-1681s1c1
Sequence:CCGGGCAAGGGAGAAGAAATCCATACTCGAGTATGGATTTCTTCTCCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021784.3-1556s1c1
Sequence:CCGGGCCCATTATGAACTCCTCTTACTCGAGTAAGAGGAGTTCATAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021784.3-314s1c1
Sequence:CCGGGAACGGCATGAACACGTACATCTCGAGATGTACGTGTTCATGCCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021784.3-686s1c1
Sequence:CCGGCTACTCGTACATCTCGCTCATCTCGAGATGAGCGAGATGTACGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021784.3-581s1c1
Sequence:CCGGCTACGCCAACATGAACTCCATCTCGAGATGGAGTTCATGTTGGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks