EMAIL THIS PAGE TO A FRIEND

FOXA3

forkhead box A3

55 Gene Product Result for
Synonyms: FKHH3 HNF3G TCF3G
UniProtKB ID: P55318, A9LYI5, Q53F16, Q9UMW9
Gene ID:
Human(3171) Summary: This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific transcripts such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. The crystal structure of a similar protein in rat has been resolved. [provided by RefSeq, Jul 2008]
Mouse(15377) forkhead box A3
Rat(25100) forkhead box A3
Zebrafish(30559) forkhead box A3
domestic cat(101081178) forkhead box A3
dog(484434) forkhead box A3
cow(503622) forkhead box A3
sheep(101119414) forkhead box A3
naked mole-rat(101702061) forkhead box A3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004497 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004497 Rosetta Predictions human pricing
NM_017077 Rosetta Predictions rat pricing
NM_008260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219786 predicted 1221
2 SASI_Hs01_00219787 predicted 596
3 SASI_Hs01_00219788 predicted 1216
4 SASI_Hs01_00219789 predicted 1207
5 SASI_Hs01_00219790 predicted 778
6 SASI_Hs01_00219791 predicted 535
7 SASI_Hs01_00219792 predicted 1329
8 SASI_Hs01_00219793 predicted 822
9 SASI_Hs01_00219794 predicted 824
10 SASI_Hs01_00219795 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096713 predicted 1214
2 SASI_Rn01_00096714 predicted 1221
3 SASI_Rn02_00261287 predicted 1227
4 SASI_Rn01_00096715 predicted 1185
5 SASI_Rn02_00261288 predicted 1247
6 SASI_Rn01_00096717 predicted 1216
7 SASI_Rn01_00096718 predicted 431
8 SASI_Rn01_00096720 predicted 797
9 SASI_Rn01_00096721 predicted 1243
10 SASI_Rn02_00261289 predicted 1193
11 SASI_Rn01_00096716 predicted 919
12 SASI_Rn01_00096719 predicted 1253
13 SASI_Rn01_00096722 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154000 predicted 1149
2 SASI_Mm01_00154001 predicted 1251
3 SASI_Mm01_00154002 predicted 1262
4 SASI_Mm02_00313476 predicted 1313
5 SASI_Mm01_00154003 predicted 1262
6 SASI_Mm01_00154004 predicted 491
7 SASI_Mm01_00154005 predicted 1245
8 SASI_Mm01_00154007 predicted 474
9 SASI_Mm02_00313477 predicted 964
10 SASI_Mm02_00313478 predicted 576
11 SASI_Mm01_00154006 predicted 721
12 SASI_Mm01_00154008 predicted 732
13 SASI_Mm01_00154009 predicted 1225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008260
VALIDATED
FOXA3 MISSION shRNA Bacterial Glycerol Stock
forkhead box A3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008260.1-1450s1c1
Sequence:CCGGGCCATATTAAGTGAAGCCATTCTCGAGAATGGCTTCACTTAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008260.1-1019s1c1
Sequence:CCGGCTATAACTTCAACCACCCTTTCTCGAGAAAGGGTGGTTGAAGTTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008260.1-230s1c1
Sequence:CCGGCAACTCCTACATGACCTTGAACTCGAGTTCAAGGTCATGTAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008260.1-1018s1c1
Sequence:CCGGCCTATAACTTCAACCACCCTTCTCGAGAAGGGTGGTTGAAGTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008260.1-541s1c1
Sequence:CCGGCCCTGAGTGAAATCTACCAATCTCGAGATTGGTAGATTTCACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008260.2-1275s21c1
Sequence:CCGGACATCTTATTTGGTCTATTACCTCGAGGTAATAGACCAAATAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008260.2-544s21c1
Sequence:CCGGCCCTGAGTGAAATCTACCAATCTCGAGATTGGTAGATTTCACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008260.2-233s21c1
Sequence:CCGGCAACTCCTACATGACCTTGAACTCGAGTTCAAGGTCATGTAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008260.2-1174s21c1
Sequence:CCGGATGCATCCTAGCAGCGCAATTCTCGAGAATTGCGCTGCTAGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008260.2-959s21c1
Sequence:CCGGTCCTTCGTCCACACCTTATTTCTCGAGAAATAAGGTGTGGACGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008260
VALIDATED
FOXA3 MISSION shRNA shRNA Plasmid DNA
forkhead box A3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008260.1-1450s1c1
Sequence:CCGGGCCATATTAAGTGAAGCCATTCTCGAGAATGGCTTCACTTAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008260.1-1019s1c1
Sequence:CCGGCTATAACTTCAACCACCCTTTCTCGAGAAAGGGTGGTTGAAGTTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008260.1-230s1c1
Sequence:CCGGCAACTCCTACATGACCTTGAACTCGAGTTCAAGGTCATGTAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008260.1-1018s1c1
Sequence:CCGGCCTATAACTTCAACCACCCTTCTCGAGAAGGGTGGTTGAAGTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008260.1-541s1c1
Sequence:CCGGCCCTGAGTGAAATCTACCAATCTCGAGATTGGTAGATTTCACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008260.2-1275s21c1
Sequence:CCGGACATCTTATTTGGTCTATTACCTCGAGGTAATAGACCAAATAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008260.2-544s21c1
Sequence:CCGGCCCTGAGTGAAATCTACCAATCTCGAGATTGGTAGATTTCACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008260.2-233s21c1
Sequence:CCGGCAACTCCTACATGACCTTGAACTCGAGTTCAAGGTCATGTAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008260.2-1174s21c1
Sequence:CCGGATGCATCCTAGCAGCGCAATTCTCGAGAATTGCGCTGCTAGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008260.2-959s21c1
Sequence:CCGGTCCTTCGTCCACACCTTATTTCTCGAGAAATAAGGTGTGGACGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008260
VALIDATED
FOXA3 MISSION shRNA Lentiviral Transduction Particles
forkhead box A3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008260.1-1450s1c1
Sequence:CCGGGCCATATTAAGTGAAGCCATTCTCGAGAATGGCTTCACTTAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008260.1-1019s1c1
Sequence:CCGGCTATAACTTCAACCACCCTTTCTCGAGAAAGGGTGGTTGAAGTTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008260.1-230s1c1
Sequence:CCGGCAACTCCTACATGACCTTGAACTCGAGTTCAAGGTCATGTAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008260.1-1018s1c1
Sequence:CCGGCCTATAACTTCAACCACCCTTCTCGAGAAGGGTGGTTGAAGTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008260.1-541s1c1
Sequence:CCGGCCCTGAGTGAAATCTACCAATCTCGAGATTGGTAGATTTCACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008260.2-1275s21c1
Sequence:CCGGACATCTTATTTGGTCTATTACCTCGAGGTAATAGACCAAATAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008260.2-544s21c1
Sequence:CCGGCCCTGAGTGAAATCTACCAATCTCGAGATTGGTAGATTTCACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008260.2-233s21c1
Sequence:CCGGCAACTCCTACATGACCTTGAACTCGAGTTCAAGGTCATGTAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008260.2-1174s21c1
Sequence:CCGGATGCATCCTAGCAGCGCAATTCTCGAGAATTGCGCTGCTAGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008260.2-959s21c1
Sequence:CCGGTCCTTCGTCCACACCTTATTTCTCGAGAAATAAGGTGTGGACGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004497
VALIDATED
FOXA3 MISSION shRNA Bacterial Glycerol Stock
forkhead box A3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004497.2-1539s1c1
Sequence:CCGGCCTTTGGGTGTGATGGTGATACTCGAGTATCACCATCACACCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004497.2-554s1c1
Sequence:CCGGGTATTCCTATATCTCACTCATCTCGAGATGAGTGAGATATAGGAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004497.2-608s1c1
Sequence:CCGGGCTGACCTTGAGTGAAATCTACTCGAGTAGATTTCACTCAAGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004497.2-1088s1c1
Sequence:CCGGCTACAACTTCAACCACCCTTTCTCGAGAAAGGGTGGTTGAAGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004497.2-1225s1c1
Sequence:CCGGCCCGCTCTTTGCTTAATGCATCTCGAGATGCATTAAGCAAAGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004497
VALIDATED
FOXA3 MISSION shRNA shRNA Plasmid DNA
forkhead box A3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004497.2-1539s1c1
Sequence:CCGGCCTTTGGGTGTGATGGTGATACTCGAGTATCACCATCACACCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004497.2-554s1c1
Sequence:CCGGGTATTCCTATATCTCACTCATCTCGAGATGAGTGAGATATAGGAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004497.2-608s1c1
Sequence:CCGGGCTGACCTTGAGTGAAATCTACTCGAGTAGATTTCACTCAAGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004497.2-1088s1c1
Sequence:CCGGCTACAACTTCAACCACCCTTTCTCGAGAAAGGGTGGTTGAAGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004497.2-1225s1c1
Sequence:CCGGCCCGCTCTTTGCTTAATGCATCTCGAGATGCATTAAGCAAAGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004497
VALIDATED
FOXA3 MISSION shRNA Lentiviral Transduction Particles
forkhead box A3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004497.2-1539s1c1
Sequence:CCGGCCTTTGGGTGTGATGGTGATACTCGAGTATCACCATCACACCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004497.2-554s1c1
Sequence:CCGGGTATTCCTATATCTCACTCATCTCGAGATGAGTGAGATATAGGAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004497.2-608s1c1
Sequence:CCGGGCTGACCTTGAGTGAAATCTACTCGAGTAGATTTCACTCAAGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004497.2-1088s1c1
Sequence:CCGGCTACAACTTCAACCACCCTTTCTCGAGAAAGGGTGGTTGAAGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004497.2-1225s1c1
Sequence:CCGGCCCGCTCTTTGCTTAATGCATCTCGAGATGCATTAAGCAAAGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks