EMAIL THIS PAGE TO A FRIEND

FOXB2

forkhead box B2

38 Gene Product Result for
Synonyms: bA159H20.4
UniProtKB ID: Q5VYV0
Gene ID:
Mouse(14240) forkhead box B2
Rat(691398) forkhead box B2
chicken(100859806) forkhead box B2
dog(608385) forkhead box B2
domestic cat(101097183) forkhead box B2
cow(613814) forkhead box B2
naked mole-rat(101702277) forkhead box B2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001013735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013735 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013735 Rosetta Predictions human pricing
XM_001078067 Rosetta Predictions rat pricing
NM_008023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090836 predicted 1266
2 SASI_Hs01_00090837 predicted 1035
3 SASI_Hs01_00090838 predicted 1076
4 SASI_Hs01_00090839 predicted 134
5 SASI_Hs01_00090841 predicted 349
6 SASI_Hs01_00090842 predicted 1238
7 SASI_Hs01_00090840 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359568 predicted 261
2 SASI_Rn02_00359569 predicted 221
3 SASI_Rn02_00359570 predicted 333
4 SASI_Rn02_00359571 predicted 354
5 SASI_Rn02_00359572 predicted 1202
6 SASI_Rn02_00359573 predicted 267
7 SASI_Rn02_00359574 predicted 345
8 SASI_Rn02_00359575 predicted 1212
9 SASI_Rn02_00359576 predicted 242
10 SASI_Rn02_00359577 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095401 predicted 225
2 SASI_Mm01_00095402 predicted 1218
3 SASI_Mm01_00095403 predicted 1259
4 SASI_Mm01_00095404 predicted 206
5 SASI_Mm01_00095405 predicted 267
6 SASI_Mm01_00095406 predicted 285
7 SASI_Mm01_00095407 predicted 1229
8 SASI_Mm01_00095408 predicted 286
9 SASI_Mm01_00095409 predicted 1285
10 SASI_Mm01_00095410 predicted 1183
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008023
FOXB2 MISSION shRNA Bacterial Glycerol Stock
forkhead box B2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-987s1c1
Sequence:CCGGCGTTCGCCATAGAGAACATCACTCGAGTGATGTTCTCTATGGCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-232s1c1
Sequence:CCGGGCCCTACTCTTACATCTCACTCTCGAGAGTGAGATGTAAGAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-703s1c1
Sequence:CCGGGCCGCACATGGTGCCCTATTTCTCGAGAAATAGGGCACCATGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-1130s1c1
Sequence:CCGGGTTGGCGTGATGGATTCGGTACTCGAGTACCGAATCCATCACGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-382s1c1
Sequence:CCGGCCTCTCCTTCAACGACTGTTTCTCGAGAAACAGTCGTTGAAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008023.1-265s21c1
Sequence:CCGGCATCCAGCATTCGGCTGAGAACTCGAGTTCTCAGCCGAATGCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008023.1-457s21c1
Sequence:CCGGACACCCTGACTGCGGTGACATCTCGAGATGTCACCGCAGTCAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008023.1-295s21c1
Sequence:CCGGTCTGAGCGACATCTACAAGTTCTCGAGAACTTGTAGATGTCGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008023
FOXB2 MISSION shRNA shRNA Plasmid DNA
forkhead box B2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-987s1c1
Sequence:CCGGCGTTCGCCATAGAGAACATCACTCGAGTGATGTTCTCTATGGCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-232s1c1
Sequence:CCGGGCCCTACTCTTACATCTCACTCTCGAGAGTGAGATGTAAGAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-703s1c1
Sequence:CCGGGCCGCACATGGTGCCCTATTTCTCGAGAAATAGGGCACCATGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-1130s1c1
Sequence:CCGGGTTGGCGTGATGGATTCGGTACTCGAGTACCGAATCCATCACGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-382s1c1
Sequence:CCGGCCTCTCCTTCAACGACTGTTTCTCGAGAAACAGTCGTTGAAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008023.1-265s21c1
Sequence:CCGGCATCCAGCATTCGGCTGAGAACTCGAGTTCTCAGCCGAATGCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008023.1-457s21c1
Sequence:CCGGACACCCTGACTGCGGTGACATCTCGAGATGTCACCGCAGTCAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008023.1-295s21c1
Sequence:CCGGTCTGAGCGACATCTACAAGTTCTCGAGAACTTGTAGATGTCGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008023
FOXB2 MISSION shRNA Lentiviral Transduction Particles
forkhead box B2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-987s1c1
Sequence:CCGGCGTTCGCCATAGAGAACATCACTCGAGTGATGTTCTCTATGGCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-232s1c1
Sequence:CCGGGCCCTACTCTTACATCTCACTCTCGAGAGTGAGATGTAAGAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-703s1c1
Sequence:CCGGGCCGCACATGGTGCCCTATTTCTCGAGAAATAGGGCACCATGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-1130s1c1
Sequence:CCGGGTTGGCGTGATGGATTCGGTACTCGAGTACCGAATCCATCACGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008023.1-382s1c1
Sequence:CCGGCCTCTCCTTCAACGACTGTTTCTCGAGAAACAGTCGTTGAAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008023.1-265s21c1
Sequence:CCGGCATCCAGCATTCGGCTGAGAACTCGAGTTCTCAGCCGAATGCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008023.1-457s21c1
Sequence:CCGGACACCCTGACTGCGGTGACATCTCGAGATGTCACCGCAGTCAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008023.1-295s21c1
Sequence:CCGGTCTGAGCGACATCTACAAGTTCTCGAGAACTTGTAGATGTCGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013735
FOXB2 MISSION shRNA Bacterial Glycerol Stock
forkhead box B2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-519s1c1
Sequence:CCGGGCCGCACATGGTACACTATTTCTCGAGAAATAGTGTACCATGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-529s1c1
Sequence:CCGGGTACACTATTTCCATCAGCAACTCGAGTTGCTGATGGAAATAGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-943s1c1
Sequence:CCGGCCGCACGTTGGCGTCATGGATCTCGAGATCCATGACGCCAACGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-339s1c1
Sequence:CCGGCGCCGACCATACTCACTTGCACTCGAGTGCAAGTGAGTATGGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-111s1c1
Sequence:CCGGCGACATCTACAAGTTCATCATCTCGAGATGATGAACTTGTAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013735
FOXB2 MISSION shRNA shRNA Plasmid DNA
forkhead box B2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-519s1c1
Sequence:CCGGGCCGCACATGGTACACTATTTCTCGAGAAATAGTGTACCATGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-529s1c1
Sequence:CCGGGTACACTATTTCCATCAGCAACTCGAGTTGCTGATGGAAATAGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-943s1c1
Sequence:CCGGCCGCACGTTGGCGTCATGGATCTCGAGATCCATGACGCCAACGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-339s1c1
Sequence:CCGGCGCCGACCATACTCACTTGCACTCGAGTGCAAGTGAGTATGGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-111s1c1
Sequence:CCGGCGACATCTACAAGTTCATCATCTCGAGATGATGAACTTGTAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013735
FOXB2 MISSION shRNA Lentiviral Transduction Particles
forkhead box B2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-519s1c1
Sequence:CCGGGCCGCACATGGTACACTATTTCTCGAGAAATAGTGTACCATGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-529s1c1
Sequence:CCGGGTACACTATTTCCATCAGCAACTCGAGTTGCTGATGGAAATAGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-943s1c1
Sequence:CCGGCCGCACGTTGGCGTCATGGATCTCGAGATCCATGACGCCAACGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-339s1c1
Sequence:CCGGCGCCGACCATACTCACTTGCACTCGAGTGCAAGTGAGTATGGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013735.1-111s1c1
Sequence:CCGGCGACATCTACAAGTTCATCATCTCGAGATGATGAACTTGTAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks