EMAIL THIS PAGE TO A FRIEND

FOXC1

forkhead box C1

149 Gene Product Result for
Synonyms: ARA FKHL7 FREAC-3 FREAC3 IGDA IHG1 IRID1 RIEG3
UniProtKB ID: Q12948, Q86UP7, Q9BYM1, Q9NUE5, Q9UDD0, Q9UP06
Gene ID:
Human(2296) Summary: This gene belongs to the forkhead family of transcription factors which is characterized by a distinct DNA-binding forkhead domain. The specific function of this gene has not yet been determined; however, it has been shown to play a role in the regulation of embryonic and ocular development. Mutations in this gene cause various glaucoma phenotypes including primary congenital glaucoma, autosomal dominant iridogoniodysgenesis anomaly, and Axenfeld-Rieger anomaly. [provided by RefSeq, Jul 2008]
Mouse(17300) forkhead box C1
Rat(364706) forkhead box C1
sheep(101102186) forkhead box C1
chicken(395856) forkhead box C1
domestic cat(101088928) forkhead box C1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001453 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU055441 MISSION® esiRNA esiRNA targeting mouse Foxc1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001453 Rosetta Predictions human pricing
XR_007064 Rosetta Predictions rat pricing
XR_008386 Rosetta Predictions rat pricing
NM_008592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331884 predicted 2104
2 SASI_Hs02_00331885 predicted 1963
3 SASI_Hs02_00331886 predicted 1970
4 SASI_Hs02_00331887 predicted 2149
5 SASI_Hs01_00237216 predicted 1620
6 SASI_Hs01_00237218 predicted 1565
7 SASI_Hs01_00237220 predicted 1570
8 SASI_Hs02_00331888 predicted 1783
9 SASI_Hs01_00237221 predicted 276
10 SASI_Hs02_00331889 predicted 1771
11 SASI_Hs01_00237217 predicted 1571
12 SASI_Hs01_00237219 predicted 1563
13 SASI_Hs01_00237222 predicted 1412
14 SASI_Hs01_00237223 predicted 1540
15 SASI_Hs01_00237224 predicted 1544
16 SASI_Hs01_00237225 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161545 predicted 3317
2 SASI_Rn01_00161546 predicted 2542
3 SASI_Rn01_00161547 predicted 2460
4 SASI_Rn02_00413590 predicted 3890
5 SASI_Rn01_00161548 predicted 2533
6 SASI_Rn02_00413591 predicted 3227
7 SASI_Rn01_00161549 predicted 2235
8 SASI_Rn01_00161551 predicted 3172
9 SASI_Rn01_00161552 predicted 2962
10 SASI_Rn01_00161553 predicted 3048
11 SASI_Rn01_00161544 predicted 906
12 SASI_Rn01_00161550 predicted 3266
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161224 predicted 3388
2 SASI_Rn01_00161225 predicted 2602
3 SASI_Rn02_00416903 predicted 253
4 SASI_Rn01_00161226 predicted 2523
5 SASI_Rn01_00161227 predicted 2601
6 SASI_Rn02_00416904 predicted 3300
7 SASI_Rn01_00161228 predicted 2293
8 SASI_Rn01_00161230 predicted 3236
9 SASI_Rn01_00161231 predicted 3026
10 SASI_Rn01_00161232 predicted 3119
11 SASI_Rn01_00161223 predicted 1047
12 SASI_Rn01_00161229 predicted 3329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025102 predicted 2216
2 SASI_Mm01_00025103 predicted 2497
3 SASI_Mm01_00025104 predicted 2531
4 SASI_Mm01_00025105 predicted 2442
5 SASI_Mm01_00025106 predicted 2195
6 SASI_Mm01_00025107 predicted 2517
7 SASI_Mm01_00025108 predicted 2443
8 SASI_Mm01_00025109 predicted 2209
9 SASI_Mm01_00025110 predicted 2232
10 SASI_Mm02_00314231 predicted 2223
11 SASI_Mm01_00025111 predicted 2357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008592
VALIDATED
FOXC1 MISSION shRNA Bacterial Glycerol Stock
forkhead box C1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008592.2-2082s21c1
Sequence:CCGGTGCGGGAAATGTTCGAGTCTCCTCGAGGAGACTCGAACATTTCCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008592.2-2638s21c1
Sequence:CCGGGAACGGGAAAGTACCTGTTTACTCGAGTAAACAGGTACTTTCCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008592.2-2212s21c1
Sequence:CCGGTAGCAAATTCTGACCCTATTCCTCGAGGAATAGGGTCAGAATTTGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008592.2-899s21c1
Sequence:CCGGCCCTTCTATCGGGACAATAAGCTCGAGCTTATTGTCCCGATAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008592.2-2125s21c1
Sequence:CCGGCCCGGTGAATGGGAATAGTAGCTCGAGCTACTATTCCCATTCACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008592.1-2187s1c1
Sequence:CCGGCGTCTATGACTGTAGCAAATTCTCGAGAATTTGCTACAGTCATAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008592.1-831s1c1
Sequence:CCGGCCCGGACAAGAAGATCACTCTCTCGAGAGAGTGATCTTCTTGTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008592.1-613s1c1
Sequence:CCGGGAGCAGAGCTACTATCGCGCTCTCGAGAGCGCGATAGTAGCTCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008592.1-2070s1c1
Sequence:CCGGGCGGGAAATGTTCGAGTCTCACTCGAGTGAGACTCGAACATTTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008592.1-2121s1c1
Sequence:CCGGTGGGAATAGTAGCTGTCAGATCTCGAGATCTGACAGCTACTATTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008592
VALIDATED
FOXC1 MISSION shRNA shRNA Plasmid DNA
forkhead box C1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008592.2-2082s21c1
Sequence:CCGGTGCGGGAAATGTTCGAGTCTCCTCGAGGAGACTCGAACATTTCCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008592.2-2638s21c1
Sequence:CCGGGAACGGGAAAGTACCTGTTTACTCGAGTAAACAGGTACTTTCCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008592.2-2212s21c1
Sequence:CCGGTAGCAAATTCTGACCCTATTCCTCGAGGAATAGGGTCAGAATTTGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008592.2-899s21c1
Sequence:CCGGCCCTTCTATCGGGACAATAAGCTCGAGCTTATTGTCCCGATAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008592.2-2125s21c1
Sequence:CCGGCCCGGTGAATGGGAATAGTAGCTCGAGCTACTATTCCCATTCACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008592.1-2187s1c1
Sequence:CCGGCGTCTATGACTGTAGCAAATTCTCGAGAATTTGCTACAGTCATAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008592.1-831s1c1
Sequence:CCGGCCCGGACAAGAAGATCACTCTCTCGAGAGAGTGATCTTCTTGTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008592.1-613s1c1
Sequence:CCGGGAGCAGAGCTACTATCGCGCTCTCGAGAGCGCGATAGTAGCTCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008592.1-2070s1c1
Sequence:CCGGGCGGGAAATGTTCGAGTCTCACTCGAGTGAGACTCGAACATTTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008592.1-2121s1c1
Sequence:CCGGTGGGAATAGTAGCTGTCAGATCTCGAGATCTGACAGCTACTATTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008592
VALIDATED
FOXC1 MISSION shRNA Lentiviral Transduction Particles
forkhead box C1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008592.2-2082s21c1
Sequence:CCGGTGCGGGAAATGTTCGAGTCTCCTCGAGGAGACTCGAACATTTCCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008592.2-2638s21c1
Sequence:CCGGGAACGGGAAAGTACCTGTTTACTCGAGTAAACAGGTACTTTCCCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008592.2-2212s21c1
Sequence:CCGGTAGCAAATTCTGACCCTATTCCTCGAGGAATAGGGTCAGAATTTGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008592.2-899s21c1
Sequence:CCGGCCCTTCTATCGGGACAATAAGCTCGAGCTTATTGTCCCGATAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008592.2-2125s21c1
Sequence:CCGGCCCGGTGAATGGGAATAGTAGCTCGAGCTACTATTCCCATTCACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008592.1-2187s1c1
Sequence:CCGGCGTCTATGACTGTAGCAAATTCTCGAGAATTTGCTACAGTCATAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008592.1-831s1c1
Sequence:CCGGCCCGGACAAGAAGATCACTCTCTCGAGAGAGTGATCTTCTTGTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008592.1-613s1c1
Sequence:CCGGGAGCAGAGCTACTATCGCGCTCTCGAGAGCGCGATAGTAGCTCTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008592.1-2070s1c1
Sequence:CCGGGCGGGAAATGTTCGAGTCTCACTCGAGTGAGACTCGAACATTTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008592.1-2121s1c1
Sequence:CCGGTGGGAATAGTAGCTGTCAGATCTCGAGATCTGACAGCTACTATTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001453
VALIDATED
FOXC1 MISSION shRNA Bacterial Glycerol Stock
forkhead box C1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001453.2-1631s21c1
Sequence:CCGGGAGCTTTCGTCTACGACTGTACTCGAGTACAGTCGTAGACGAAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001453.2-1536s21c1
Sequence:CCGGGTCACAGAGGATCGGCTTGAACTCGAGTTCAAGCCGATCCTCTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001453.2-1559s21c1
Sequence:CCGGACTCTCCAGTGAACGGGAATACTCGAGTATTCCCGTTCACTGGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001453.2-522s21c1
Sequence:CCGGCAAGAAGAAGGACGCGGTGAACTCGAGTTCACCGCGTCCTTCTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001453.2-2978s21c1
Sequence:CCGGCGGGTTGGAAAGGGATATTTACTCGAGTAAATATCCCTTTCCAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-1179s1c1
Sequence:CCGGCCACTGCAACCTGCAAGCCATCTCGAGATGGCTTGCAGGTTGCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-282s1c1
Sequence:CCGGCCCGGACAAGAAGATCACCCTCTCGAGAGGGTGATCTTCTTGTCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-674s1c1
Sequence:CCGGACATCAAGACCGAGAACGGTACTCGAGTACCGTTCTCGGTCTTGATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-903s1c1
Sequence:CCGGGCCGCACCATAGCCAGGGCTTCTCGAGAAGCCCTGGCTATGGTGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-1407s1c1
Sequence:CCGGCCTCACCTCGTGGTACCTGAACTCGAGTTCAGGTACCACGAGGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001453
VALIDATED
FOXC1 MISSION shRNA shRNA Plasmid DNA
forkhead box C1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001453.2-1631s21c1
Sequence:CCGGGAGCTTTCGTCTACGACTGTACTCGAGTACAGTCGTAGACGAAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001453.2-1536s21c1
Sequence:CCGGGTCACAGAGGATCGGCTTGAACTCGAGTTCAAGCCGATCCTCTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001453.2-1559s21c1
Sequence:CCGGACTCTCCAGTGAACGGGAATACTCGAGTATTCCCGTTCACTGGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001453.2-522s21c1
Sequence:CCGGCAAGAAGAAGGACGCGGTGAACTCGAGTTCACCGCGTCCTTCTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001453.2-2978s21c1
Sequence:CCGGCGGGTTGGAAAGGGATATTTACTCGAGTAAATATCCCTTTCCAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-1179s1c1
Sequence:CCGGCCACTGCAACCTGCAAGCCATCTCGAGATGGCTTGCAGGTTGCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-282s1c1
Sequence:CCGGCCCGGACAAGAAGATCACCCTCTCGAGAGGGTGATCTTCTTGTCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-674s1c1
Sequence:CCGGACATCAAGACCGAGAACGGTACTCGAGTACCGTTCTCGGTCTTGATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-903s1c1
Sequence:CCGGGCCGCACCATAGCCAGGGCTTCTCGAGAAGCCCTGGCTATGGTGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-1407s1c1
Sequence:CCGGCCTCACCTCGTGGTACCTGAACTCGAGTTCAGGTACCACGAGGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001453
VALIDATED
FOXC1 MISSION shRNA Lentiviral Transduction Particles
forkhead box C1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001453.2-1631s21c1
Sequence:CCGGGAGCTTTCGTCTACGACTGTACTCGAGTACAGTCGTAGACGAAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001453.2-1536s21c1
Sequence:CCGGGTCACAGAGGATCGGCTTGAACTCGAGTTCAAGCCGATCCTCTGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001453.2-1559s21c1
Sequence:CCGGACTCTCCAGTGAACGGGAATACTCGAGTATTCCCGTTCACTGGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001453.2-522s21c1
Sequence:CCGGCAAGAAGAAGGACGCGGTGAACTCGAGTTCACCGCGTCCTTCTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001453.2-2978s21c1
Sequence:CCGGCGGGTTGGAAAGGGATATTTACTCGAGTAAATATCCCTTTCCAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-1179s1c1
Sequence:CCGGCCACTGCAACCTGCAAGCCATCTCGAGATGGCTTGCAGGTTGCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-282s1c1
Sequence:CCGGCCCGGACAAGAAGATCACCCTCTCGAGAGGGTGATCTTCTTGTCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-674s1c1
Sequence:CCGGACATCAAGACCGAGAACGGTACTCGAGTACCGTTCTCGGTCTTGATGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-903s1c1
Sequence:CCGGGCCGCACCATAGCCAGGGCTTCTCGAGAAGCCCTGGCTATGGTGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001453.1-1407s1c1
Sequence:CCGGCCTCACCTCGTGGTACCTGAACTCGAGTTCAGGTACCACGAGGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)