EMAIL THIS PAGE TO A FRIEND

FOXD1

forkhead box D1

77 Gene Product Result for
Synonyms: FKHL8 FREAC4
UniProtKB ID: Q16676, Q12949
Gene ID:
Human(2297) Summary: This intronless gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in tumor formation. [provided by RefSeq, Jul 2008]
Mouse(15229) forkhead box D1
Rat(171299) forkhead box D1
naked mole-rat(101724798) forkhead box D1
Zebrafish(30525) forkhead box D1
chicken(396109) forkhead box D1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004472 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU178891 MISSION® esiRNA esiRNA targeting mouse Foxd1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004472 Rosetta Predictions human pricing
XM_001057782 Rosetta Predictions rat pricing
NM_008242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049794 predicted 1827
2 SASI_Hs01_00049796 predicted 1973
3 SASI_Hs01_00049797 predicted 1856
4 SASI_Hs01_00049798 predicted 1684
5 SASI_Hs01_00049799 predicted 1686
6 SASI_Hs01_00049800 predicted 1738
7 SASI_Hs01_00049801 predicted 1687
8 SASI_Hs02_00337683 predicted 1743
9 SASI_Hs02_00337684 predicted 1846
10 SASI_Hs01_00049803 predicted 1730
11 SASI_Hs01_00049795 predicted 1921
12 SASI_Hs01_00049802 predicted 2057
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287551 predicted 1732
2 SASI_Rn02_00287552 predicted 1711
3 SASI_Rn02_00287553 predicted 1708
4 SASI_Rn02_00287554 predicted 1745
5 SASI_Rn02_00287555 predicted 1700
6 SASI_Rn02_00287556 predicted 1682
7 SASI_Rn02_00287557 predicted 1773
8 SASI_Rn02_00287558 predicted 1653
9 SASI_Rn02_00287559 predicted 1687
10 SASI_Rn02_00287560 predicted 1712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035338 predicted 1719
2 SASI_Mm01_00035339 predicted 1710
3 SASI_Mm01_00035343 predicted 1770
4 SASI_Mm02_00313432 predicted 737
5 SASI_Mm02_00313433 predicted 740
6 SASI_Mm01_00035344 predicted 1723
7 SASI_Mm01_00035345 predicted 1729
8 SASI_Mm01_00035346 predicted 1700
9 SASI_Mm02_00313434 predicted 1766
10 SASI_Mm02_00313435 predicted 1696
11 SASI_Mm01_00035340 predicted 1630
12 SASI_Mm01_00035341 predicted 1691
13 SASI_Mm01_00035342 predicted 1751
14 SASI_Mm01_00035347 predicted 1750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008242
FOXD1 MISSION shRNA Bacterial Glycerol Stock
forkhead box D1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008242.2-2135s21c1
Sequence:CCGGATGTTTAAATGCAGCTTATAGCTCGAGCTATAAGCTGCATTTAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008242.2-1859s21c1
Sequence:CCGGTTTCGCCGCTTCGGATTCTTGCTCGAGCAAGAATCCGAAGCGGCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008242.2-1468s21c1
Sequence:CCGGTTCTCCATCGAGAGCCTCATCCTCGAGGATGAGGCTCTCGATGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008242.1-1692s1c1
Sequence:CCGGCTGTCCAGTGTGGAGAACTTTCTCGAGAAAGTTCTCCACACTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008242.1-734s1c1
Sequence:CCGGCGCTAAGAATCCGCTGGTGAACTCGAGTTCACCAGCGGATTCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008242.1-2184s1c1
Sequence:CCGGCACACTTGTTTGGTAGACTTTCTCGAGAAAGTCTACCAAACAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008242.1-992s1c1
Sequence:CCGGGTCCGCAGATATGTTCGACAACTCGAGTTGTCGAACATATCTGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008242
FOXD1 MISSION shRNA shRNA Plasmid DNA
forkhead box D1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008242.2-2135s21c1
Sequence:CCGGATGTTTAAATGCAGCTTATAGCTCGAGCTATAAGCTGCATTTAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008242.2-1859s21c1
Sequence:CCGGTTTCGCCGCTTCGGATTCTTGCTCGAGCAAGAATCCGAAGCGGCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008242.2-1468s21c1
Sequence:CCGGTTCTCCATCGAGAGCCTCATCCTCGAGGATGAGGCTCTCGATGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008242.1-1692s1c1
Sequence:CCGGCTGTCCAGTGTGGAGAACTTTCTCGAGAAAGTTCTCCACACTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008242.1-734s1c1
Sequence:CCGGCGCTAAGAATCCGCTGGTGAACTCGAGTTCACCAGCGGATTCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008242.1-2184s1c1
Sequence:CCGGCACACTTGTTTGGTAGACTTTCTCGAGAAAGTCTACCAAACAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008242.1-992s1c1
Sequence:CCGGGTCCGCAGATATGTTCGACAACTCGAGTTGTCGAACATATCTGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008242
FOXD1 MISSION shRNA Lentiviral Transduction Particles
forkhead box D1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008242.2-2135s21c1
Sequence:CCGGATGTTTAAATGCAGCTTATAGCTCGAGCTATAAGCTGCATTTAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008242.2-1859s21c1
Sequence:CCGGTTTCGCCGCTTCGGATTCTTGCTCGAGCAAGAATCCGAAGCGGCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008242.2-1468s21c1
Sequence:CCGGTTCTCCATCGAGAGCCTCATCCTCGAGGATGAGGCTCTCGATGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008242.1-1692s1c1
Sequence:CCGGCTGTCCAGTGTGGAGAACTTTCTCGAGAAAGTTCTCCACACTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008242.1-734s1c1
Sequence:CCGGCGCTAAGAATCCGCTGGTGAACTCGAGTTCACCAGCGGATTCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008242.1-2184s1c1
Sequence:CCGGCACACTTGTTTGGTAGACTTTCTCGAGAAAGTCTACCAAACAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008242.1-992s1c1
Sequence:CCGGGTCCGCAGATATGTTCGACAACTCGAGTTGTCGAACATATCTGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004472
VALIDATED
FOXD1 MISSION shRNA Bacterial Glycerol Stock
forkhead box D1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004472.2-1557s21c1
Sequence:CCGGTTGTTAATAACGCTATGTTAGCTCGAGCTAACATAGCGTTATTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004472.2-1533s21c1
Sequence:GTACCGGGAACTTTACTGCTAGGATTTCCTCGAGGAAATCCTAGCAGTAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004472.2-1740s21c1
Sequence:CCGGCTCTGCGGGTCCCTCTATTTACTCGAGTAAATAGAGGGACCCGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004472.2-551s21c1
Sequence:CCGGCGTATATCGCGCTCATCACTACTCGAGTAGTGATGAGCGCGATATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004472.2-207s21c1
Sequence:CCGGCGAGGAAACAGACATCGACGTCTCGAGACGTCGATGTCTGTTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004472.1-2110s1c1
Sequence:CCGGCCTTGACGTTTGGCAGATGAACTCGAGTTCATCTGCCAAACGTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004472.1-1492s1c1
Sequence:CCGGGCCCTTCTCCATCGAGAGCATCTCGAGATGCTCTCGATGGAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004472.1-1767s1c1
Sequence:CCGGTGTCCAGTGTCGAGAACTTTACTCGAGTAAAGTTCTCGACACTGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004472.1-448s1c1
Sequence:CCGGCCTCGCCGAGGAAACAGACATCTCGAGATGTCTGTTTCCTCGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004472.1-1778s1c1
Sequence:CCGGGAGAACTTTACTGCTAGGATTCTCGAGAATCCTAGCAGTAAAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004472
VALIDATED
FOXD1 MISSION shRNA shRNA Plasmid DNA
forkhead box D1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004472.2-1557s21c1
Sequence:CCGGTTGTTAATAACGCTATGTTAGCTCGAGCTAACATAGCGTTATTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004472.2-1533s21c1
Sequence:GTACCGGGAACTTTACTGCTAGGATTTCCTCGAGGAAATCCTAGCAGTAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004472.2-1740s21c1
Sequence:CCGGCTCTGCGGGTCCCTCTATTTACTCGAGTAAATAGAGGGACCCGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004472.2-551s21c1
Sequence:CCGGCGTATATCGCGCTCATCACTACTCGAGTAGTGATGAGCGCGATATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004472.2-207s21c1
Sequence:CCGGCGAGGAAACAGACATCGACGTCTCGAGACGTCGATGTCTGTTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004472.1-2110s1c1
Sequence:CCGGCCTTGACGTTTGGCAGATGAACTCGAGTTCATCTGCCAAACGTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004472.1-1492s1c1
Sequence:CCGGGCCCTTCTCCATCGAGAGCATCTCGAGATGCTCTCGATGGAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004472.1-1767s1c1
Sequence:CCGGTGTCCAGTGTCGAGAACTTTACTCGAGTAAAGTTCTCGACACTGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004472.1-448s1c1
Sequence:CCGGCCTCGCCGAGGAAACAGACATCTCGAGATGTCTGTTTCCTCGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004472.1-1778s1c1
Sequence:CCGGGAGAACTTTACTGCTAGGATTCTCGAGAATCCTAGCAGTAAAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004472
VALIDATED
FOXD1 MISSION shRNA Lentiviral Transduction Particles
forkhead box D1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004472.2-1557s21c1
Sequence:CCGGTTGTTAATAACGCTATGTTAGCTCGAGCTAACATAGCGTTATTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004472.2-1533s21c1
Sequence:GTACCGGGAACTTTACTGCTAGGATTTCCTCGAGGAAATCCTAGCAGTAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004472.2-1740s21c1
Sequence:CCGGCTCTGCGGGTCCCTCTATTTACTCGAGTAAATAGAGGGACCCGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004472.2-551s21c1
Sequence:CCGGCGTATATCGCGCTCATCACTACTCGAGTAGTGATGAGCGCGATATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004472.2-207s21c1
Sequence:CCGGCGAGGAAACAGACATCGACGTCTCGAGACGTCGATGTCTGTTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004472.1-2110s1c1
Sequence:CCGGCCTTGACGTTTGGCAGATGAACTCGAGTTCATCTGCCAAACGTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004472.1-1492s1c1
Sequence:CCGGGCCCTTCTCCATCGAGAGCATCTCGAGATGCTCTCGATGGAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004472.1-1767s1c1
Sequence:CCGGTGTCCAGTGTCGAGAACTTTACTCGAGTAAAGTTCTCGACACTGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004472.1-448s1c1
Sequence:CCGGCCTCGCCGAGGAAACAGACATCTCGAGATGTCTGTTTCCTCGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004472.1-1778s1c1
Sequence:CCGGGAGAACTTTACTGCTAGGATTCTCGAGAATCCTAGCAGTAAAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks