EMAIL THIS PAGE TO A FRIEND

FOXD2

forkhead box D2

137 Gene Product Result for
Synonyms: FKHL17 FREAC-9 FREAC9
UniProtKB ID: O60548, Q5SVZ3
Gene ID:
Human(2306) Summary: This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(17301) forkhead box D2
Rat(313504) forkhead box D2
chicken(395795) forkhead box D2
cow(614839) forkhead box D2
dog(610256) forkhead box D2
sheep(101114157) forkhead box D2
naked mole-rat(101702650) forkhead box D2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0574 AQUA Peptide GAAPPG[V]TR human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004474 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004474 Rosetta Predictions human pricing
XM_001069350 Rosetta Predictions rat pricing
XM_233422 Rosetta Predictions rat pricing
NM_008593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150108 predicted 3668
2 SASI_Hs01_00150109 predicted 3824
3 SASI_Hs01_00150110 predicted 3743
4 SASI_Hs01_00150113 predicted 3623
5 SASI_Hs01_00150114 predicted 3766
6 SASI_Hs02_00337685 predicted 3733
7 SASI_Hs02_00337686 predicted 3506
8 SASI_Hs01_00150111 predicted 3818
9 SASI_Hs01_00150112 predicted 3681
10 SASI_Hs01_00150115 predicted 3509
11 SASI_Hs01_00150116 predicted 3817
12 SASI_Hs01_00150117 predicted 4054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327711 predicted 1654
2 SASI_Rn02_00327712 predicted 1653
3 SASI_Rn02_00327713 predicted 1602
4 SASI_Rn02_00327714 predicted 490
5 SASI_Rn02_00327715 predicted 220
6 SASI_Rn02_00327716 predicted 1649
7 SASI_Rn02_00327717 predicted 1318
8 SASI_Rn02_00327718 predicted 1656
9 SASI_Rn02_00327719 predicted 1600
10 SASI_Rn02_00327720 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387732 predicted 1755
2 SASI_Rn02_00387733 predicted 1753
3 SASI_Rn02_00387734 predicted 1705
4 SASI_Rn02_00387735 predicted 225
5 SASI_Rn02_00387736 predicted 1761
6 SASI_Rn02_00387737 predicted 1544
7 SASI_Rn02_00387738 predicted 1761
8 SASI_Rn02_00387739 predicted 1445
9 SASI_Rn02_00387740 predicted 1703
10 SASI_Rn02_00387741 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314232 predicted 1619
2 SASI_Mm02_00314233 predicted 1617
3 SASI_Mm02_00314234 predicted 1745
4 SASI_Mm02_00314235 predicted 1567
5 SASI_Mm02_00314236 predicted 1569
6 SASI_Mm02_00314237 predicted 1618
7 SASI_Mm01_00197865 predicted 1360
8 SASI_Mm02_00314238 predicted 1752
9 SASI_Mm01_00197866 predicted 447
10 SASI_Mm01_00197867 predicted 450
11 SASI_Mm01_00197864 predicted 848
12 SASI_Mm01_00197868 predicted 1291
13 SASI_Mm01_00197869 predicted 1127
14 SASI_Mm01_00197870 predicted 439
15 SASI_Mm01_00197871 predicted 442
16 SASI_Mm01_00197872 predicted 444
17 SASI_Mm01_00197873 predicted 850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008593
FOXD2 MISSION shRNA Bacterial Glycerol Stock
forkhead box D2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-431s1c1
Sequence:CCGGCCTCTGGTGAAACCACCTTATCTCGAGATAAGGTGGTTTCACCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-439s1c1
Sequence:CCGGGAAACCACCTTATTCGTACATCTCGAGATGTACGAATAAGGTGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-1262s1c1
Sequence:CCGGACAGGCCAGAGGCCTTCCTTTCTCGAGAAAGGAAGGCCTCTGGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-749s1c1
Sequence:CCGGCCACCGCATCCACACCCGCATCTCGAGATGCGGGTGTGGATGCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-850s1c1
Sequence:CCGGCGGCGCTTACGGCTACGGCTACTCGAGTAGCCGTAGCCGTAAGCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008593.3-1498s21c1
Sequence:CCGGTGTCTTCAGGGCCCTCGTTTGCTCGAGCAAACGAGGGCCCTGAAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008593.3-103s21c1
Sequence:CCGGAGATCATGTCCTCCGAGAGCTCTCGAGAGCTCTCGGAGGACATGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008593
FOXD2 MISSION shRNA shRNA Plasmid DNA
forkhead box D2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-431s1c1
Sequence:CCGGCCTCTGGTGAAACCACCTTATCTCGAGATAAGGTGGTTTCACCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-439s1c1
Sequence:CCGGGAAACCACCTTATTCGTACATCTCGAGATGTACGAATAAGGTGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-1262s1c1
Sequence:CCGGACAGGCCAGAGGCCTTCCTTTCTCGAGAAAGGAAGGCCTCTGGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-749s1c1
Sequence:CCGGCCACCGCATCCACACCCGCATCTCGAGATGCGGGTGTGGATGCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-850s1c1
Sequence:CCGGCGGCGCTTACGGCTACGGCTACTCGAGTAGCCGTAGCCGTAAGCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008593.3-1498s21c1
Sequence:CCGGTGTCTTCAGGGCCCTCGTTTGCTCGAGCAAACGAGGGCCCTGAAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008593.3-103s21c1
Sequence:CCGGAGATCATGTCCTCCGAGAGCTCTCGAGAGCTCTCGGAGGACATGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008593
FOXD2 MISSION shRNA Lentiviral Transduction Particles
forkhead box D2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-431s1c1
Sequence:CCGGCCTCTGGTGAAACCACCTTATCTCGAGATAAGGTGGTTTCACCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-439s1c1
Sequence:CCGGGAAACCACCTTATTCGTACATCTCGAGATGTACGAATAAGGTGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-1262s1c1
Sequence:CCGGACAGGCCAGAGGCCTTCCTTTCTCGAGAAAGGAAGGCCTCTGGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-749s1c1
Sequence:CCGGCCACCGCATCCACACCCGCATCTCGAGATGCGGGTGTGGATGCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008593.1-850s1c1
Sequence:CCGGCGGCGCTTACGGCTACGGCTACTCGAGTAGCCGTAGCCGTAAGCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008593.3-1498s21c1
Sequence:CCGGTGTCTTCAGGGCCCTCGTTTGCTCGAGCAAACGAGGGCCCTGAAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008593.3-103s21c1
Sequence:CCGGAGATCATGTCCTCCGAGAGCTCTCGAGAGCTCTCGGAGGACATGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004474
FOXD2 MISSION shRNA Bacterial Glycerol Stock
forkhead box D2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004474.1-2316s1c1
Sequence:CCGGCGAGGCAGACTTAGCCGAGGACTCGAGTCCTCGGCTAAGTCTGCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004474.1-4039s1c1
Sequence:CCGGCCCTGCTTGTCCAATATTATACTCGAGTATAATATTGGACAAGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004474.1-3366s1c1
Sequence:CCGGCTTCTCTATAGACCACATCATCTCGAGATGATGTGGTCTATAGAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004474.1-3360s1c1
Sequence:CCGGGCCTTCCTTCTCTATAGACCACTCGAGTGGTCTATAGAGAAGGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004474.3-3750s21c1
Sequence:CCGGCGCACAGAATCTCGCAGATAGCTCGAGCTATCTGCGAGATTCTGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004474.3-3560s21c1
Sequence:CCGGTCCCGGTTTGCCAGCAAAGTCCTCGAGGACTTTGCTGGCAAACCGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004474.3-3827s21c1
Sequence:CCGGGTCGCAGGCCAAGATTCTTTACTCGAGTAAAGAATCTTGGCCTGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004474.3-3675s21c1
Sequence:CCGGGCGGAACTCAGGGAGTCTATTCTCGAGAATAGACTCCCTGAGTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004474.3-2656s21c1
Sequence:CCGGCTCTCTCAACGACTGCTTCGTCTCGAGACGAAGCAGTCGTTGAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004474
FOXD2 MISSION shRNA shRNA Plasmid DNA
forkhead box D2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004474.1-2316s1c1
Sequence:CCGGCGAGGCAGACTTAGCCGAGGACTCGAGTCCTCGGCTAAGTCTGCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004474.1-4039s1c1
Sequence:CCGGCCCTGCTTGTCCAATATTATACTCGAGTATAATATTGGACAAGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004474.1-3366s1c1
Sequence:CCGGCTTCTCTATAGACCACATCATCTCGAGATGATGTGGTCTATAGAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004474.1-3360s1c1
Sequence:CCGGGCCTTCCTTCTCTATAGACCACTCGAGTGGTCTATAGAGAAGGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004474.3-3750s21c1
Sequence:CCGGCGCACAGAATCTCGCAGATAGCTCGAGCTATCTGCGAGATTCTGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004474.3-3560s21c1
Sequence:CCGGTCCCGGTTTGCCAGCAAAGTCCTCGAGGACTTTGCTGGCAAACCGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004474.3-3827s21c1
Sequence:CCGGGTCGCAGGCCAAGATTCTTTACTCGAGTAAAGAATCTTGGCCTGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004474.3-3675s21c1
Sequence:CCGGGCGGAACTCAGGGAGTCTATTCTCGAGAATAGACTCCCTGAGTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004474.3-2656s21c1
Sequence:CCGGCTCTCTCAACGACTGCTTCGTCTCGAGACGAAGCAGTCGTTGAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004474
FOXD2 MISSION shRNA Lentiviral Transduction Particles
forkhead box D2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004474.1-2316s1c1
Sequence:CCGGCGAGGCAGACTTAGCCGAGGACTCGAGTCCTCGGCTAAGTCTGCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004474.1-4039s1c1
Sequence:CCGGCCCTGCTTGTCCAATATTATACTCGAGTATAATATTGGACAAGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004474.1-3366s1c1
Sequence:CCGGCTTCTCTATAGACCACATCATCTCGAGATGATGTGGTCTATAGAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004474.1-3360s1c1
Sequence:CCGGGCCTTCCTTCTCTATAGACCACTCGAGTGGTCTATAGAGAAGGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004474.3-3750s21c1
Sequence:CCGGCGCACAGAATCTCGCAGATAGCTCGAGCTATCTGCGAGATTCTGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004474.3-3560s21c1
Sequence:CCGGTCCCGGTTTGCCAGCAAAGTCCTCGAGGACTTTGCTGGCAAACCGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004474.3-3827s21c1
Sequence:CCGGGTCGCAGGCCAAGATTCTTTACTCGAGTAAAGAATCTTGGCCTGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004474.3-3675s21c1
Sequence:CCGGGCGGAACTCAGGGAGTCTATTCTCGAGAATAGACTCCCTGAGTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004474.3-2656s21c1
Sequence:CCGGCTCTCTCAACGACTGCTTCGTCTCGAGACGAAGCAGTCGTTGAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)