EMAIL THIS PAGE TO A FRIEND

FOXD3

forkhead box D3

55 Gene Product Result for
Synonyms: AIS1 Genesis HFH2 VAMAS2
UniProtKB ID: Q9UJU5, Q9BYM2, Q9UDD1
Gene ID:
Human(27022) Summary: This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. Mutations in this gene cause autoimmune susceptibility 1. [provided by RefSeq, Nov 2008]
Mouse(15221) forkhead box D3
Rat(29203) forkhead box D3
Zebrafish(30548) forkhead box D3
cow(532383) forkhead box D3
domestic cat(101100237) forkhead box D3
chicken(395794) forkhead box D3
dog(489558) forkhead box D3
naked mole-rat(101728365) forkhead box D3
sheep(101102030) forkhead box D3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32561 Anti-FOXD3 antibody produced in rabbit affinity isolated antibody canine, bovine, mouse, human
western blot pricing
SAB4501183 Anti-FOXD3 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB5300097 Monoclonal Anti-FOXD3 antibody produced in mouse clone 5G9, ascites fluid human, monkey, mouse
ELISA, western blot pricing
SAB5300098 Monoclonal Anti-FOXD3 antibody produced in mouse clone 5G9, ascites fluid human, monkey, mouse
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012183 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU081081 MISSION® esiRNA esiRNA targeting mouse Foxd3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012183 Rosetta Predictions human pricing
XM_001061117 Rosetta Predictions rat pricing
XM_575873 Rosetta Predictions rat pricing
NM_010425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011568 predicted 1090
2 SASI_Hs01_00011569 predicted 681
3 SASI_Hs01_00011570 predicted 1125
4 SASI_Hs02_00343800 predicted 1619
5 SASI_Hs02_00343801 predicted 1620
6 SASI_Hs01_00011572 predicted 1324
7 SASI_Hs02_00343802 predicted 1426
8 SASI_Hs01_00011573 predicted 745
9 SASI_Hs02_00343803 predicted 1665
10 SASI_Hs01_00011574 predicted 413
11 SASI_Hs01_00011571 predicted 1342
12 SASI_Hs01_00011575 predicted 1331
13 SASI_Hs01_00011576 predicted 742
14 SASI_Hs01_00011577 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298824 predicted 387
2 SASI_Rn02_00298825 predicted 209
3 SASI_Rn02_00298826 predicted 456
4 SASI_Rn02_00298827 predicted 718
5 SASI_Rn02_00298828 predicted 457
6 SASI_Rn02_00298829 predicted 669
7 SASI_Rn02_00298830 predicted 702
8 SASI_Rn02_00298831 predicted 380
9 SASI_Rn02_00298832 predicted 429
10 SASI_Rn02_00298833 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575873 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404458 predicted 871
2 SASI_Rn02_00404459 predicted 688
3 SASI_Rn02_00404460 predicted 358
4 SASI_Rn02_00404461 predicted 678
5 SASI_Rn02_00404462 predicted 941
6 SASI_Rn02_00404463 predicted 479
7 SASI_Rn02_00404464 predicted 940
8 SASI_Rn02_00404465 predicted 866
9 SASI_Rn02_00404466 predicted 913
10 SASI_Rn02_00404467 predicted 1540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095764 predicted 798
2 SASI_Mm01_00095765 predicted 1794
3 SASI_Mm01_00095766 predicted 1838
4 SASI_Mm01_00095767 predicted 517
5 SASI_Mm01_00095769 predicted 768
6 SASI_Mm01_00095770 predicted 1783
7 SASI_Mm01_00095771 predicted 516
8 SASI_Mm01_00095772 predicted 798
9 SASI_Mm01_00095773 predicted 755
10 SASI_Mm02_00318577 predicted 1794
11 SASI_Mm01_00095768 predicted 1832
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010425
FOXD3 MISSION shRNA Bacterial Glycerol Stock
forkhead box D3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010425.3-1312s21c1
Sequence:CCGGGCCTGCAGCTACAGCTCAACACTCGAGTGTTGAGCTGTAGCTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010425.3-2051s21c1
Sequence:CCGGAGGGACATTCTTTGTACATATCTCGAGATATGTACAAAGAATGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010425.2-1936s1c1
Sequence:CCGGGCTGGGAATAACTTTCCAGTACTCGAGTACTGGAAAGTTATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010425.2-793s1c1
Sequence:CCGGCGAGTTCATCAGCAACCGTTTCTCGAGAAACGGTTGCTGATGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010425.2-1627s1c1
Sequence:CCGGCGTGCCGCTGTCTGGACAGTTCTCGAGAACTGTCCAGACAGCGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010425.2-1396s1c1
Sequence:CCGGGCCGTCGTTCAGCATCGAGAACTCGAGTTCTCGATGCTGAACGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010425.2-718s1c1
Sequence:CCGGCTACTCTTACATCGCGCTCATCTCGAGATGAGCGCGATGTAAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010425
FOXD3 MISSION shRNA shRNA Plasmid DNA
forkhead box D3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010425.3-1312s21c1
Sequence:CCGGGCCTGCAGCTACAGCTCAACACTCGAGTGTTGAGCTGTAGCTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010425.3-2051s21c1
Sequence:CCGGAGGGACATTCTTTGTACATATCTCGAGATATGTACAAAGAATGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010425.2-1936s1c1
Sequence:CCGGGCTGGGAATAACTTTCCAGTACTCGAGTACTGGAAAGTTATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010425.2-793s1c1
Sequence:CCGGCGAGTTCATCAGCAACCGTTTCTCGAGAAACGGTTGCTGATGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010425.2-1627s1c1
Sequence:CCGGCGTGCCGCTGTCTGGACAGTTCTCGAGAACTGTCCAGACAGCGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010425.2-1396s1c1
Sequence:CCGGGCCGTCGTTCAGCATCGAGAACTCGAGTTCTCGATGCTGAACGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010425.2-718s1c1
Sequence:CCGGCTACTCTTACATCGCGCTCATCTCGAGATGAGCGCGATGTAAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010425
FOXD3 MISSION shRNA Lentiviral Transduction Particles
forkhead box D3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010425.3-1312s21c1
Sequence:CCGGGCCTGCAGCTACAGCTCAACACTCGAGTGTTGAGCTGTAGCTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010425.3-2051s21c1
Sequence:CCGGAGGGACATTCTTTGTACATATCTCGAGATATGTACAAAGAATGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010425.2-1936s1c1
Sequence:CCGGGCTGGGAATAACTTTCCAGTACTCGAGTACTGGAAAGTTATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010425.2-793s1c1
Sequence:CCGGCGAGTTCATCAGCAACCGTTTCTCGAGAAACGGTTGCTGATGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010425.2-1627s1c1
Sequence:CCGGCGTGCCGCTGTCTGGACAGTTCTCGAGAACTGTCCAGACAGCGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010425.2-1396s1c1
Sequence:CCGGGCCGTCGTTCAGCATCGAGAACTCGAGTTCTCGATGCTGAACGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010425.2-718s1c1
Sequence:CCGGCTACTCTTACATCGCGCTCATCTCGAGATGAGCGCGATGTAAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012183
FOXD3 MISSION shRNA Bacterial Glycerol Stock
forkhead box D3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012183.2-1843s21c1
Sequence:CCGGTAGAGCTCTGAACTTTCATTTCTCGAGAAATGAAAGTTCAGAGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012183.2-1626s21c1
Sequence:CCGGACCTAAGCTGGTCGAGCAAACCTCGAGGTTTGCTCGACCAGCTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012183.2-1667s21c1
Sequence:CCGGATAGCTTTCCATACAGGTAAACTCGAGTTTACCTGTATGGAAAGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-1097s1c1
Sequence:CCGGCGCTCATCAAGTCCGAGCCAACTCGAGTTGGCTCGGACTTGATGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-1135s1c1
Sequence:CCGGAGCATCGAGAACATCATAGGTCTCGAGACCTATGATGTTCTCGATGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-58s1c1
Sequence:CCGGGCCGAGGACGTGGACATCGATCTCGAGATCGATGTCCACGTCCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-413s1c1
Sequence:CCGGGCCTAGTGAAGCCGCCTTACTCTCGAGAGTAAGGCGGCTTCACTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-1237s1c1
Sequence:CCGGGCGCAGTCGTTTCTGCGGCCACTCGAGTGGCCGCAGAAACGACTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012183
FOXD3 MISSION shRNA shRNA Plasmid DNA
forkhead box D3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012183.2-1843s21c1
Sequence:CCGGTAGAGCTCTGAACTTTCATTTCTCGAGAAATGAAAGTTCAGAGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012183.2-1626s21c1
Sequence:CCGGACCTAAGCTGGTCGAGCAAACCTCGAGGTTTGCTCGACCAGCTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012183.2-1667s21c1
Sequence:CCGGATAGCTTTCCATACAGGTAAACTCGAGTTTACCTGTATGGAAAGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-1097s1c1
Sequence:CCGGCGCTCATCAAGTCCGAGCCAACTCGAGTTGGCTCGGACTTGATGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-1135s1c1
Sequence:CCGGAGCATCGAGAACATCATAGGTCTCGAGACCTATGATGTTCTCGATGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-58s1c1
Sequence:CCGGGCCGAGGACGTGGACATCGATCTCGAGATCGATGTCCACGTCCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-413s1c1
Sequence:CCGGGCCTAGTGAAGCCGCCTTACTCTCGAGAGTAAGGCGGCTTCACTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-1237s1c1
Sequence:CCGGGCGCAGTCGTTTCTGCGGCCACTCGAGTGGCCGCAGAAACGACTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012183
FOXD3 MISSION shRNA Lentiviral Transduction Particles
forkhead box D3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012183.2-1843s21c1
Sequence:CCGGTAGAGCTCTGAACTTTCATTTCTCGAGAAATGAAAGTTCAGAGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012183.2-1626s21c1
Sequence:CCGGACCTAAGCTGGTCGAGCAAACCTCGAGGTTTGCTCGACCAGCTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012183.2-1667s21c1
Sequence:CCGGATAGCTTTCCATACAGGTAAACTCGAGTTTACCTGTATGGAAAGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-1097s1c1
Sequence:CCGGCGCTCATCAAGTCCGAGCCAACTCGAGTTGGCTCGGACTTGATGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-1135s1c1
Sequence:CCGGAGCATCGAGAACATCATAGGTCTCGAGACCTATGATGTTCTCGATGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-58s1c1
Sequence:CCGGGCCGAGGACGTGGACATCGATCTCGAGATCGATGTCCACGTCCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-413s1c1
Sequence:CCGGGCCTAGTGAAGCCGCCTTACTCTCGAGAGTAAGGCGGCTTCACTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012183.1-1237s1c1
Sequence:CCGGGCGCAGTCGTTTCTGCGGCCACTCGAGTGGCCGCAGAAACGACTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks