EMAIL THIS PAGE TO A FRIEND

FOXD4L1

forkhead box D4-like 1

24 Gene Product Result for
Synonyms: FOXD5 bA395L14.1
UniProtKB ID: Q9NU39, B3KWN1, B9EGF3
Gene ID:
Human(200350) Summary: This gene is a member of the forkhead/winged-helix (FOX) family of transcription factors with highly conserved FOX DNA-binding domains. Members of the FOX family of transcription factors are regulators of embryogenesis and may play a role in human cancer. This gene lies in a region of chromosome 2 that surrounds the site where two ancestral chromosomes fused to form human chromosome 2. This region is duplicated elsewhere in the human genome, primarily in subtelomeric and pericentromeric locations, thus mutiple copies of this gene have been found. [provided by RefSeq, Jul 2008]
cow(529657) forkhead box D4-like 1
sheep(101116383) forkhead box D4-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012184 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012184 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343804 predicted 1724
2 SASI_Hs01_00245855 predicted 1245
3 SASI_Hs02_00343805 predicted 1771
4 SASI_Hs01_00245861 predicted 1364
5 SASI_Hs02_00343806 predicted 1716
6 SASI_Hs02_00343807 predicted 1718
7 SASI_Hs02_00343808 predicted 1823
8 SASI_Hs02_00343809 predicted 1590
9 SASI_Hs01_00245853 predicted 1900
10 SASI_Hs02_00343810 predicted 1846
11 SASI_Hs01_00245852 predicted 1634
12 SASI_Hs01_00245854 predicted 777
13 SASI_Hs01_00245856 predicted 1555
14 SASI_Hs01_00245857 predicted 549
15 SASI_Hs01_00245858 predicted 1493
16 SASI_Hs01_00245859 predicted 1399
17 SASI_Hs01_00245860 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012184
FOXD4L1 MISSION shRNA Bacterial Glycerol Stock
forkhead box D4-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012184.4-1873s21c1
Sequence:CCGGAGTGTTATTCCTAAGTCTAGTCTCGAGACTAGACTTAGGAATAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012184.4-1627s21c1
Sequence:CCGGAGAAAGAAACAGCTGGATTACCTCGAGGTAATCCAGCTGTTTCTTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012184.4-421s21c1
Sequence:CCGGCAGAGTTTGGCACCGAGTTCACTCGAGTGAACTCGGTGCCAAACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012184.4-655s21c1
Sequence:CCGGTGAACGACTGCTTCGTCAAGACTCGAGTCTTGACGAAGCAGTCGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012184.3-575s1c1
Sequence:CCGGCGCCTTCATTAGTGGCCGCTTCTCGAGAAGCGGCCACTAATGAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012184
FOXD4L1 MISSION shRNA shRNA Plasmid DNA
forkhead box D4-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012184.4-1873s21c1
Sequence:CCGGAGTGTTATTCCTAAGTCTAGTCTCGAGACTAGACTTAGGAATAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012184.4-1627s21c1
Sequence:CCGGAGAAAGAAACAGCTGGATTACCTCGAGGTAATCCAGCTGTTTCTTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012184.4-421s21c1
Sequence:CCGGCAGAGTTTGGCACCGAGTTCACTCGAGTGAACTCGGTGCCAAACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012184.4-655s21c1
Sequence:CCGGTGAACGACTGCTTCGTCAAGACTCGAGTCTTGACGAAGCAGTCGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012184.3-575s1c1
Sequence:CCGGCGCCTTCATTAGTGGCCGCTTCTCGAGAAGCGGCCACTAATGAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012184
FOXD4L1 MISSION shRNA Lentiviral Transduction Particles
forkhead box D4-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012184.4-1873s21c1
Sequence:CCGGAGTGTTATTCCTAAGTCTAGTCTCGAGACTAGACTTAGGAATAACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012184.4-1627s21c1
Sequence:CCGGAGAAAGAAACAGCTGGATTACCTCGAGGTAATCCAGCTGTTTCTTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012184.4-421s21c1
Sequence:CCGGCAGAGTTTGGCACCGAGTTCACTCGAGTGAACTCGGTGCCAAACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012184.4-655s21c1
Sequence:CCGGTGAACGACTGCTTCGTCAAGACTCGAGTCTTGACGAAGCAGTCGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012184.3-575s1c1
Sequence:CCGGCGCCTTCATTAGTGGCCGCTTCTCGAGAAGCGGCCACTAATGAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)